1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
3 years ago
8

What defines radial symmetry?

Biology
1 answer:
miv72 [106K]3 years ago
4 0

Answer:

A

Explanation:

symmetry about a central axis, as in a starfish or a tulip flower

You might be interested in
Given that tina jones has 20/40 vision in her right eye, what safety goals would you set for tina's decreased vision? which evid
Norma-Jean [14]

Answer:

Healthy food, exercise and use of sunglasses.

Explanation:

Safety goals for tina's decreased vision is to eat a balanced and healthy diet rich in antioxidants and vitamin A, Get enough sleep, doing regular exercise, Wear sunglasses in order to protect your eyes from the sun, Wear eye protection in order to protect the eyes from injury. these practices work because there effectiveness are scientifically proven.

7 0
3 years ago
Which statement best describes cellular resperstion?
pentagon [3]

Answer:

C

Explanation:

Cellular respiration is the aerobic process by which living cells break down glucose molecules, release energy, and form molecules of ATP. Overall, this three-stage process involves glucose and oxygen reacting to form carbon dioxide and water.

8 0
3 years ago
Which of the following sequences shows a frameshift mutation compared to the wild-type mRNA sequence?
Butoxors [25]

Option C:

B. wild-type 5-AUGCAUACAUUGGAGUGA-3 mutant 5'-AUGCAUACAUCUGGAGUGA- 3' 

Explanation:

A frameshift mutation is a genetic mutation such that the triplet nature of gene expression by codons, the insertion or deletion occurs in such as way that it alters the complete sequence of 3 codon sets and can change the reading frame, resulting in a completely different translation from the original.

As it is pertinent to understanding that all genes are normally translated in sets of 3 codons, which typically describes and explain a unique amino acid sequence. Thus, if a frame shift mutation occurs, it can affect many amino acid sequences and finally the entire protein.  

If we look at option B:

wild-type 5-AUG   CAU  ACA  UUG  GAG  UGA-3  

mutant 5’-    AUG   CAU  ACA  UCU  GGA  GUG  A-3’  

An insertion of a base Uracil showed at the end of 3rd codon which affected and altered the whole sequence of codon triplets. This changed all next codons and finally all next amino acids will be altered.

8 0
3 years ago
What are strategies used by organisms to survive in an ecosystem ?
LenKa [72]

Answer:

Some animals have camouflage which helps them not get eaten.

Explanation:

3 0
3 years ago
Read 2 more answers
Which statement is true for both plants and animals? Plants and animals both use sunlight to generate ATP for energy. Plants and
KengaRu [80]

Answer is  Plants and animals both break a phosphate bond of ATP to release energy.

In both plants and animals adenosine triphosphate (ATP) is the main molecule for storing and transferring energy in cells. It is also called the energy currency of the cell.  ATP molecule composed of three phosphate groups. These phosphate groups are linked to one another by two high-energy phosphoanhydride bonds. When energy is required by the cell, one a phosphoanhydride is bond broken removing one phosphate. As a result energy is released and ATP is converted to adenosine diphosphate (ADP).

8 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What properties of water make it so critical to life and earth's processes?
    7·2 answers
  • How can sedimentary rock show earths history
    11·2 answers
  • What clues could you use to help determine whether movement of oslutes through the apicl and basolateral cell membranes is passi
    12·1 answer
  • What is the general name for a cell that is capable of receiving signals through its receptors?
    13·2 answers
  • The human body is composed of cells, organs, organ systems, and tissues. How are these organized?​
    13·1 answer
  • What is the green house effect?
    6·1 answer
  • The stem cells of plants have an unusual tubular structure unlike most other types of plant cells. What function of plant stem c
    12·1 answer
  • Which process indicates how a mountain range slowly wears down over time?
    13·1 answer
  • treatment for PTSD campus be described A.multumodal multi-phasic b. atheoretical C. stress inclusion D.eclectic​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!