1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tanya [424]
3 years ago
14

A student observes that in the middle of the day the sun is higher in the sky in summer than in winter. Which of the following s

tatements explains her observation?
The orientation of the earth’s axis relative to the sun is different in summer than it is in winter.
The orientation of the earth’s axis relative to the plane of the earth’s path around the sun is different in summer than it is in winter.
The difference is not caused by changes in the orientation of the earth’s axis.
It is caused by changes in the sun’s position in the solar system.
The difference is not caused by changes in the orientation of the earth’s axis.
It is caused by the days in summer is longer than days in winter.
Biology
2 answers:
LuckyWell [14K]3 years ago
8 0

It is caused by changes in the sun’s position in the solar system. It is because the days in winter are shorter which has a change a change in the position from the sun.

Virty [35]3 years ago
7 0

It is caused by changes in the suns position in the solar system

You might be interested in
which type of organism moves nitrogen from cells of producers back to the soil. A) decomposers b) consumers c) nitrogen-fixing b
kiruha [24]
The answer is a decomposers

4 0
3 years ago
Although viruses are nonliving,
svlad2 [7]

Answer: B

Explanation:

They inject their DNA into the cell, which reprograms that cell to become that virus. This is why viruses are so deadly and can spread throughout the body and to others easily, and efficiently.

7 0
3 years ago
What are sessile algae?
Vedmedyk [2.9K]
A holdfast is a root-like structure that anchors aquatic sessile organisms, such as seaweed, other sessile algae, stalked crinoids, benthic cnidarians, and sponges, to the substrate.
3 0
3 years ago
What is the significance of Carbon cycle on plants, animals, ocean, and forest.
Lena [83]

Answer:

Carbon moves from the atmosphere to plants. In the atmosphere, carbon is attached to oxygen in a gas called carbon dioxide (CO2). Through the process of photosynthesis, carbon dioxide is pulled from the air to produce food made from carbon for plant growth. Carbon moves from plants to animals.

Explanation:

4 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Which statement best summarizes Gregor Mendel's contribution to science?
    14·2 answers
  • Besides the nucleus what else is broken down during prophase
    14·1 answer
  • Movement of water on or near the surface of the water is called a deep current. Please select the best answer from the choices p
    11·2 answers
  • Which of the following groups of people would be the least affected by air pollution?
    14·2 answers
  • What molecules does the fruit represent
    6·1 answer
  • Sugars from the food that we eat are a form of _______ energy that is broken down in the process of cellular respiration.
    10·1 answer
  • During the process of photosynthesis, green plants produce...
    7·1 answer
  • 2 Choose from the following words to fill in the blanks of the steps in DNA replication. Each one may be used only once. identic
    10·1 answer
  • Weathering breaks rock into sediments. Water, wind, and moving ice carry away the
    9·1 answer
  • Need help with my work that all
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!