1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Eva8 [605]
3 years ago
13

What are the two gases that animals exchange with their environment?

Biology
1 answer:
Mamont248 [21]3 years ago
3 0
Oxygen and carbon dioxide. ☺♥
You might be interested in
Graph y = -2x +3 and its inverse.
Gnesinka [82]
The graph of y = -2x + 3 is a straight line

Its slope is - 2

Its y-intercept is + 3

To draw the line you can use these two points (0,3) and (3/2 , 0)

This line does ont pass through the third quadrant. It comes downward from the second quadrant, touches the y-axis at y =3, continues on the rirst quadrant, touches the x-axis at x = 3/2, and contiues into the fourth quadrant.


Graph of its inverse

Exchange y and x in the given function and solve for the new y

x = - 2y + 3 => y = - x/2 + 3/2

It is also a straight line;
Its slope is -1/2
Its y-intercept is 3/2

It is also in the second, first and fourth quadrant

Use these two points to draw the line (0,3/2) and (3,0).

You do not need to know to draw this, but the inverse of a function is its reflection through the line y =x.


  
6 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Put these in order from smallest to largest: neuron, cell, synapse
vladimir1956 [14]

Answer:

, cell, Synapse,  Neuron,

Explanation:

6 0
2 years ago
Read 2 more answers
The alleles for height are labeled T for tall and t for short. If the resulting plant is tt, it will be _____. Question 11 optio
lesya692 [45]
B) short because it has both t alleles and no T alleles
5 0
3 years ago
Which of the following is an enzyme required by the process of rephosphory,to create ATP? A) AD Pase B)AT Pase C)Polymerase D)AT
iren [92.7K]

ATPase is the enzyme which is required to create ATP and is denoted as option B.

<h3>What is ATPase?</h3>

This type of enzyme is found in the mitochondrion and catalyzes the formation of ATP which provides energy to cells.

The ATP which is referred to as adenosine triphosphate is formed from the molecules known as ADP and inorganic phosphate which are present in the body cells. This ensures that the daily energy needs of the body are met.

Read more about ATPase here brainly.com/question/250287

#SPJ1

8 0
2 years ago
Other questions:
  • Living near the ocean is great because the weather is mild. this is because
    14·1 answer
  • ________ are enzyme used during replication to attach okazaki fragments to each other.
    13·1 answer
  • When the more dense crust dives into the asthenosphere, it continues to pull the rest of the crust with it. This is called _____
    9·1 answer
  • Water is warmed by the sun and evaporates because
    7·2 answers
  • What type of molecules are shown moving across the membrane?
    9·1 answer
  • What kind of cell does a turtle have
    15·2 answers
  • In the savannas in Africa, elephants and giraffes both use acacia trees for food. What impact would removing these large animals
    14·2 answers
  • Demetri is a participant in an auditory detection study using the method of constant stimuli. He never detects the 10 unit tone.
    13·1 answer
  • Based on the reading, why is it important for all citizens to fulfill their civic duties.
    10·1 answer
  • [20 POINTS!!!!!]
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!