1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka57 [31]
4 years ago
9

Identify the correct breakdown and translation of the term onychophagia.

Biology
1 answer:
JulsSmile [24]4 years ago
3 0
Ony-cho-pha-gia

hope this helps

You might be interested in
Which of the following contains more biodiversity? <br> A. food chain <br> B. food web
myrzilka [38]
The food web contains more biodiversity
Hope this helps
8 0
3 years ago
Read 2 more answers
What are producers called?
atroni [7]
The answer is autotrophs! They get energy from chemicals or the sun✌

Hope it helps
7 0
3 years ago
Which accurately describes the function of the electron transport system (ETS)?
SVEN [57.7K]
You are familiar with the electron transport system in photosynthesis that takes light energy and converts it to chemical bond energy in the form of ATP and NADPH. This electron transport chain in cellular respiration will take the energy stored in NADH and FADH2 during the Krebs cycle and convert it to chemical bond energy in the form of ATP. In eukaryotes, this reaction takes place on the inner mitochondrial membrane, as is shown in Figure 4.26. Prokaryotes that undergo aerobic respiration also have an electron transport chain located within their plasma membrane, which may be highly folded similar to the inner membrane of the mitochondrion. Thats the answer my friend hope it helps
4 0
3 years ago
What needs to occur for natural selection to happen? *
Artyom0805 [142]

Answer:

Four conditions are needed for natural selection to occur: reproduction, heredity, variation in fitness or organisms, variation in individual characters among members of the population. If they are met, natural selection automatically results.

Explanation:

5 0
3 years ago
Read 2 more answers
Which of the following is an example of mutualism? (1 point)
ira [324]
The following is an example of mutualism; <span>Bacteria live in root nodules of a plant, processing nitrogen into ammonia for the plant and receiving protection and a steady food supply in return. The correct answer will be A. </span>
4 0
4 years ago
Other questions:
  • Speciation has definitely occurred when two groups of related organisms
    9·2 answers
  • Source-control programs are aimed at limiting the cultivation and production of illicit drugs.
    13·1 answer
  • Organisms that follow a slow life history pettern
    12·1 answer
  • Which endocrine gland controls the secretions of the pituitary gland?
    5·1 answer
  • What is the only type of heat transfer that can travel through space
    7·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • I liedmy mum that was offering economics and she said she'll go to my school cuz I came late what should I do please​
    14·2 answers
  • Which is not an example of capillary actions ?
    9·1 answer
  • What color would the solution in the test tube be after being in the light and what would it be if it were the placed in the dar
    8·1 answer
  • innate immune suppression by sars-cov-2 mrna vaccinations: the role of g-quadruplexes, exosomes, and micrornas
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!