1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alekssr [168]
3 years ago
12

A scientist observes the ocean tides moving large amounts of sand from one part of the beach to another. This is evidence for wh

ich type of process?
Biology
1 answer:
DaniilM [7]3 years ago
5 0
<span><span /></span><span><span>Wave power, frequency and direction, seabed angle, longshore drift, rips and undertow, wind strength, direction and continuity, fetch, coastal geomorphology, sediment availability, offshore currents, and probably other variables.There are a lot, I hope one of these work for you.
</span></span><span><span /></span><span><span /></span><span><span /></span><span />
You might be interested in
What are the cause and effect relationships driven by variations in the flow of energy into and out of Earth's systems?
ValentinkaMS [17]

A balance of this two process must be maintained in order to attain a constant earth temperature.

<h3>Energy flow in the earth</h3>

The earth in itself is a massive ecosystem. Energy flows into the earth and out of it. The only source of energy input to the earth is the sun. Also, energy is lost from the earth via re-radiation of energy in the form of infrared rays.

However, this inflow and out flow of energy affects the temperature of the earth. A balance of this two process must be maintained in order to attain a constant earth temperature.

Learn more about ecosystem: brainly.com/question/1673533

5 0
2 years ago
Which body feature do ultramarathon runners count on to give their muscles fuel for endurance? Group of answer choices Toned lig
igomit [66]

Answer:An ultra-marathon can also be defined as a running competition ... World records in female elite and age group athletes in distance-limited races, from ... as skeletal muscle mass, body fat and running training were examined in ... for a long time, and do not make any tempo changes

3 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Best answer gets brainlyest what are the building blocks of life?
Effectus [21]
Cells are usually what teachers teach as the “building blocks” of life.
hope that helps :)
5 0
2 years ago
Read 2 more answers
If the liver cells of an animal have 24 chromosomes, how many chromosomes do its sperm cells have
dalvyx [7]
Sperm will have 23 chromosomes while the egg has 23 chromosomes
8 0
3 years ago
Other questions:
  • What is the benefit of an uneven production of gametes in oogensis?
    9·2 answers
  • Which of the following is correct about a muscle contraction?
    11·2 answers
  • Scientific thinking: how can scientists assess the health risks of trans fats
    15·1 answer
  • What are two body systems that are used to heal a broken bone?
    8·2 answers
  • Frank has Klinefelter syndrome (47, XXY). His mother has normal skin, but his father has anhidrotic ectodermal dysplasia, an X-l
    5·1 answer
  • Which organism is NOT likely to be found in the tundra biome?
    12·2 answers
  • Describe the thickness of the uterus lining during<br> menstruation process.
    8·2 answers
  • A baseball is thrown a distance of 50 meters. What is the speed if it takes 2 seconds to cover that distance?
    5·2 answers
  • How does regular exercise improve the muscular system
    14·1 answer
  • Explain why chloroplasts are found only in plant cells?​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!