1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrrafil [7]
2 years ago
7

Umbilical cord blood is a rich source of stem cells. Which possible advance in biology would most likely be a result of performi

ng research with an individual’s banked cord blood?
Biology
2 answers:
Ivan2 years ago
7 0

Answer:

Explanation:

In placental mammals the umbilical cord is the birth cord which connects the developing fetus with the mother. The fetus receives oxygen and nutrients from the umbilical cord during the gestation period.

The umbilical cord consists of many stem cells. These cells can be used to treat many immune system disorders as these cells can be used to replace the abnormal or non-functional cells. Thus can be used to treat cancer, anemia and other disorders which affects the immunity of the body. The umbilical cord blood is easy to collect and it consists of stem cells 10 times more than the stem cells collected from the bone marrow.

grandymaker [24]2 years ago
4 0
Possibly curing cancer or another disease
You might be interested in
Which process does the sun use to produce energy?
Andrew [12]
Fusion is the process which sun use to produce energy

3 0
3 years ago
Read 2 more answers
Sickle-cell anemia is an example of codominance. What implications does this have for people with one or two copies of the sickl
pogonyaev

Answer: B - People with two copies of the mutated gene have sickle-cell anemia. People with one copy of the mutated gene have both healthy and misshapen red blood cells and are carriers of the disease.

Explanation:

Co-dominance is when both the alleles of a gene in a heterozygote show. In the case of sickle cell anemia (since it is a co-dominant trait) even if the person only has one sickle cell allele, symptoms of sickle cell will still show up in that person. That's why the person in this example has both misshapen and healthy red blood cells.

6 0
3 years ago
Read 2 more answers
In which supereon did single-celled organisms first form in Earth
Morgarella [4.7K]
<span>Your answer is Precambrian.</span>
4 0
3 years ago
Read 2 more answers
Name the process that takes place in glomerulus​
devlian [24]
<h2>ultrafiltration</h2><h2>______________</h2><h2>FOLLOW ME</h2>
3 0
3 years ago
This image shows street lights powered by solar panels. Which sequence shows the energy transformations taking place in these li
Crazy boy [7]

C. Radiant Energy —> Electric Energy —> Radiant Energy

5 0
2 years ago
Read 2 more answers
Other questions:
  • Sociology is the study of: (lo1.2) how urges, drives, and the mind account for human behavior. group-level dynamics and social s
    6·1 answer
  • Which of the following best describes electric charge?
    5·1 answer
  • In eukaryotes, glycolysis typically occurs in the _____, gluconeogenesis typically occurs in the _____
    5·1 answer
  • 6) How does an offspring of a mushroom or mold (asexual reproduction) compare to its parent?
    13·1 answer
  • Name a star that is very dim and red
    10·2 answers
  • The free-energy changes of the individual steps in a pathway are summed to determine the overall free-energy change.
    11·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • During the action of ATP synthase, the _____ energy of the proton gradient is transformed into _____ energy of the F1 subunit, a
    8·1 answer
  • Humans are more like<br> animals such as rabbits than plant's<br> because
    15·1 answer
  • What feature controls how tightly linked two genes are?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!