1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
15

How can human population growth affect ecosystems like rain forests?

Biology
2 answers:
Alexandra [31]3 years ago
8 0
The answer would be C because people destroying rain forests for homes and resources are diminishing animal homes and animal population <span />
Arturiano [62]3 years ago
7 0

Answer: c.) human population growth causes an increase in the use of resources from rain forests.

Explanation:

The human population is directly dependent upon the surrounding environment for their daily requirement of resources. The rainforests receives a maximum amount of annual rainfall as compared to the other biome this favors the growth and abundance of valuable vegetation in this region. The rainforests are the source of rubber, cocoa, papaya, orchids, wood yielding trees and other valuable varieties sold commercially. With the advent of the human population growth the dependency on the rainforests for resources will also increase.  

You might be interested in
What is the main function of the crispr-cas9 system?
Rainbow [258]

Answer:

CRISPR-Cas9 is a unique technology that enables geneticists and medical researchers to edit parts of the genome? by removing, adding or altering sections of the DNA? sequence. It is currently the simplest, most versatile and precise method of genetic manipulation and is therefore causing a buzz in the science world.

Explanation:

Hopefully this helps you if it does please mark brainliest

8 0
3 years ago
Please help me fast smart people
Otrada [13]
D. 5
I hope this helps :)
4 0
3 years ago
Why is the cycle of natural disaster ➡ secondary succession an important and recurring process in ecosystems? (In other words, w
Makovka662 [10]

Answer:

Secondary succession takes place where a disturbance did not eliminate all life and nutrients from the environment. ... Buried seeds can sprout shortly after the effects of the disturbance pass, and some may have greater success from reduced competition and reduced shading.

Explanation:

4 0
2 years ago
In the northern hemisphere, the ______ occurs on June 21 or 22
Ede4ka [16]
The summer solstice
4 0
3 years ago
Features of euglena as a plant​
DerKrebs [107]

Answer:

The Features of Euglena are:

1. Euglena has chloroplasts that allow it to photosynthesize.

2. Primitive eye-spot which detects light.

3. Euglena lacks a cell wall.

Explanation:

6 0
2 years ago
Other questions:
  • 7
    13·1 answer
  • Which of the following is not a tissue type?
    9·2 answers
  • The human population is now about
    5·1 answer
  • According to cell theory, which are made of cells? check all that apply
    12·1 answer
  • A wild-type chromosome can be represented as ABC[*]DEFGH, and from this a chromosomal aberration arises that can be represented
    9·1 answer
  • What has caused the greenhouse effect to become imbalanced? *
    13·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is a dominant gene?
    14·2 answers
  • A subducting oceanic plate
    10·1 answer
  • How do the herbivores in a savanna habitat avoid competition?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!