1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
5

Which of the following BEST describes the process of evolution?

Biology
2 answers:
Jet001 [13]3 years ago
6 0
The process of evolution is best described by the word gradual. It's a slow steady process which takes place over thousands of years
WITCHER [35]3 years ago
5 0
C. Gradual

Hope this helps!
You might be interested in
he viral capsid _______. Multiple Choice is dissolved engulfs the viral spikes surrounds the viral matrix protein becomes comple
Studentka2010 [4]

Answer:

Becomes completely enclosed by the region of the cell membrane into which the spikes and matrix protein are embedded

Explanation:

The viral capsid is a <em>protein shell that sorrounds a virus</em>, it serves as a criterion for the classification of viruses and <em>it encloses the genetic material of the virus and it has glycoproteins (spikes and matrix) embedded in it.</em>

I hope you find this information sueful and interesting! Good luck!

7 0
3 years ago
Which of the following is an example of a stratovolcano
Oksana_A [137]

Answer:

Los volcanes Villarrica, Llaima, Volcán Osorno, Chillán (en Chile), Nevado de Colima, Volcán Ceboruco, Popocatépetl (en México)ejemplos de estratovolcanes

8 0
3 years ago
Sharks and whales look similar, but they’re different types of animals. Whales are mammals, while sharks are fish. Which body pa
DedPeter [7]

Answer:

Gills

Explanation:

Sharks are fishes and thus have gills through which they absorb oxygen from the water.

On the other hand,  Whales being mammals use lungs to breathe. They can’t directly obtain oxygen from water.

7 0
3 years ago
What is binomial nomenclature? <br>​
Mrrafil [7]

Answer:

In taxonomy, binomial nomenclature ("two-term naming system"), also called binominal nomenclature ("two-name naming system") or binary nomenclature, is a formal system of naming species of living things by giving each a name composed of two parts, both of which use Latin grammatical forms, although they can be based on words from other languages. Such a name is called a binomial name (which may be shortened to just "binomial"), a binomen, binominal name or a scientific name; more informally it is also called a Latin name.

5 0
3 years ago
Read 2 more answers
Please help!!!
Amiraneli [1.4K]
I think its B possibly
4 0
3 years ago
Read 2 more answers
Other questions:
  • How energy is transferred through a food web and food chain using the law of conservation of energy?
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • When teaching a class of new parents about the needs of their newborn, the nurse explains that the newborn's voiding is a good i
    15·1 answer
  • Which physical change takes place when an igneous rock turns into sedimentary rock?
    8·2 answers
  • A rare genetic condition causes dwarfism and immunodeficiencies. Which of the following is the most likely cause of this conditi
    6·1 answer
  • 7. Why do the Amoeba Sisters consider the mitochondrion a big deal?
    11·1 answer
  • Hi! I need you guys help asap.
    8·1 answer
  • NASA has a secret meeting that they code name the ""council of__""
    5·1 answer
  • In July, Barrow, Alaska (latitude 71.2° N), receives 24 hours of
    6·1 answer
  • what evolutionary mechanism is most likely to explain the frequency of alleles involved in aging according to the mutation accum
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!