1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
3 years ago
8

Which physical change takes place when an igneous rock turns into sedimentary rock?

Biology
2 answers:
miss Akunina [59]3 years ago
6 0
A pressure increases
Setler79 [48]3 years ago
3 0
Hello

A. will be your answer.

Hope This Helps
You might be interested in
The maintenance of homeostasis a. involves using material culture to make living possible in certain settings. b. involves the s
sweet [91]

Answer: C. Involves the replication of environmental conditions and human responces to those conditions

Explanation:

5 0
3 years ago
A thin-shelled crab can more readily move to escape a predator than can a thick-shelled crab, but it is more vulnerable to preda
Illusion [34]

Answer:

Stabilizing selection

Explanation:

Stabilizing selection is the most common form of natural selection that is not easy to notice in a population as the change is less drastic.  It occurs when average or intermediate phenotypes of a trait in a population are favored, while the extreme phenotypes of that trait are not favored by the forces of natural selection. Over time, intermediate or non-extreme traits become more common in the population, while extreme traits become less common.

5 0
3 years ago
A girl rides her scooter 5m North, 7m East, 5m South, and then 7m west. What is her displacement?
OlgaM077 [116]

Answer:

She is in the same place as she started. But she did move 28 units in total.

4 0
2 years ago
This is a model to help students understand the process of photosynthesis, which allows plants to create their own food. The GRE
mihalych1998 [28]
<span>it is incomplete and does not show all reactants and products.</span>
3 0
3 years ago
Read 2 more answers
Name three types of organisms that are made of plant cells?
ZanzabumX [31]
Mosses,ferns and thallophytes

4 0
3 years ago
Other questions:
  • How is it possible for a baby to show traits that neither parent showed?
    13·2 answers
  • What does the tryptophan bind to when it is present in E. coli?
    11·2 answers
  • While water molecules are polar. They are also very small. One fact not mentioned on the video is that some water molecules are
    14·1 answer
  • Which stage of the cell cycle can lead to uncontrollable reproduction in mutated cells?
    8·2 answers
  • What is the harmul result when exesseve amout of fat is burned?
    14·1 answer
  • Is it risky using hair spray as a flame thrower?
    8·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Lactase deficiency is more common in Asian, Native American, Mediterranean and some African populations than it is among people
    14·1 answer
  • If the black line represents a reaction without an enzyme and the red line represents the same reaction with the addition of an
    5·1 answer
  • Why is having many sense organs an advantage for an animal?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!