1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stellarik [79]
3 years ago
13

Which piece of evidence supports the theory of continental drift? A. similar animal fossils found in South America and Africa B.

transform boundaries found near tropical coastal regions C. large deposits of volcanic rocks found on the ocean floor D. fossils of plants that typically grew in Arctic climates found in Africa
Biology
1 answer:
bearhunter [10]3 years ago
7 0
A:similar animal fossils found in South America and Africa
You might be interested in
A student's grade goes from a 95 to a 65 in 3 weeks. Calculate
steposvetlana [31]

-10grade/week

Explanation:

Given parameters:

Initial grade = 95grade

Final grade = 65grade

Time = 3weeks

Unknown parameter:

Rate of change of grade = ?

Solution:

Rate is defined as the change of a quantity with time.

 Rate of change of grade  = \frac{Final grade - Initial grade}{Time}

Rate of change of grade  = \frac{65 - 95}{3} = \frac{-30}{3}

Rate of change of grade = -10grade/week

The rate of change of the student's grade is -10grade/week. It implies that the grade of the student reduces by 10unit per week.

5 0
2 years ago
Who developed the principle of Biological Succession?
Whitepunk [10]
Charles Darwin James
4 0
3 years ago
Number 14 please I'm not sure if it is right
cricket20 [7]
The actual answer is, "A", an ocean trench.

You can find out more about them by researching them up on Google, it's only a few phrases and a hit on the enter key :P
8 0
3 years ago
During sensation and perception, sensory receptors on the skin transduce information and then send this information to
rewona [7]

The area of the brain located in the parietal lobe, responsible for processing information from sensory receptors on the skin is the <u>somatosensory cortex</u>.

<h3>What is somatosensory cortex?</h3>

It is that brain area responsible for processing and treating information of a sensory nature that comes from the skin, muscles and joints.

<h3>Characteristics of somatosensory cortex</h3>

  • It receives and interprets all the information that comes from the tactile system.

  • Sensations of pain, temperature, pressure, as well as the ability to perceive the size, texture, and shape of objects are perceived by this section of the cerebral cortex.

Therefore, we can conclude that the sensory receptors receive information from the outside regarding touch, pain and temperature and transmit it to the somatosensory cortex.

Learn more about somatosensory cortex here: brainly.com/question/8340880

4 0
2 years ago
Humans have altered the carbon cycle by
zloy xaker [14]

Answer:D) all of the above

Explanation:these are all correct because they all affect our environment

4 0
2 years ago
Read 2 more answers
Other questions:
  • Fibers exiting the sympathetic chain ganglia, take one of three routes: the spinal nerve route, the sympathetic nerve route, and
    12·1 answer
  • What are the roles of biosphere and ecosystem
    6·2 answers
  • Most life forms cannot use N2 as it exists in the atmosphere. ___________ are able to convert N2 to reactive nitrogen, which can
    5·1 answer
  • If a DNA strand has 63 nucleotides, how many codons are in the sequence?
    9·1 answer
  • In olden days,parents were regaeded as educators,and educators as parents.​
    7·1 answer
  • How many legs does a water bear have?
    8·1 answer
  • Describe the role of each of these white blood cells: <br> • T cells:<br> • B cells:
    15·1 answer
  • What is the projected result of converting 25% or less of crop and rangelands in the United States to forests with native trees?
    5·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • How can multiple pollinators share the same habitat if they all need pollen?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!