1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Veronika [31]
3 years ago
8

There are many people opposed to stem cell research based on ethical grounds. This is because the stem cells used are most often

taken from human embryos.
However, many are still in favor of stem cell research. One of the reasons is
A) that stem cells are widely available.
B) that stem cells can treat diseases with no other cure.
C) that stem cells won't result in negative side effects.
D) that stem cell research is the most cost effective treatment.
Biology
2 answers:
aivan3 [116]3 years ago
5 0
The answer is B) that stem cells can treat diseases with no other cure.
inn [45]3 years ago
5 0

The Answer is B. that stem cells can treat diseases with no other cure

Hope this helps...............

You might be interested in
Real life example of block and tackle
lianna [129]

A group of people are building a house. They have a large package of building materials that needs to be moved. A block and tackle, a type of pulley, is used to pull the material up so it can be set in the back of a truck.

3 0
2 years ago
How many amino acids could be specified if codons consisted of two nucleotides instead of three? What problem would this present
Greeley [361]

Answer:

This could result in a mutation.

Explanation:

A change in the DNA can affect the work of cells because it can cause a mutation; it can be a good mutation or bad. The three main mutations that occur are Insertion, Deletion and Substitution. Insertion is when DNA base(s) are added in, Deletion is when DNA base(s) are removed. Lastly, Substitution is when DNA base(s) are switched on. All of these mutations can have effects. These effects are Silent effect, Missence, and Nonsense. Silent effect is a mutation that does not change the sequence of amino acids in a protein. Missence is a mutation that causes the sequence of amino acids to change. This can cause incorrect protein folding and protein malfunction. Nonsense is a mutation that causes an early stop codon. This effect leads to a protein that is too small. Also a Frameshift can occur. Framshift is when the reading of a frameshift is moved over by one or more bases such that every subsequent amino acid changes. An example of a frameshift is THE CAT ATE THE RAT. If you insert an A at the Beginning this happens ATH ECA TAT ETH ERA T. IN Conclusion there are two Mutations that also play a role in this Point Mutation and Chromosomal Mutaion. Point Mutation is when a single DNA base is either substituted, inserted or deleted from the sequence. Chromocomal Mutation is when large pieces of a chromosome or an entire chromosome is either substituted, inserted or deleted.

7 0
2 years ago
Which of the following is not a part of environmental science?
zalisa [80]
The answer is letter D.) the components of a cell

Environmental science is an interdisciplinary field that studies the interactions of the environment. The component of a cell can be studied through the lens of biology and may not require addition disciplines.

<span>Thank you for posting your question. I hope you found what you were after. Please feel free to ask me more</span>


8 0
3 years ago
Read 2 more answers
In horses, the allele for a black coat (B) is dominant over the allele for a brown coat (b). A cross between a black horse and a
GaryK [48]

Answer:

Bb X bb

Explanation:

  • It is given that the allele B for the black coat is dominant over allele b for a brown coat.
  • A dominant allele always leads to the expression of the dominant trait in the heterozygous condition. 
  • When a black and brown horse is crossed as given in the question and the result is a brown foal, then the genotype of the brown foal must be bb as the brown coat is a recessive trait. 
  • Since each parent contributes one allele each for a given gene, the black horse must have b allele, and hence must be heterozygous Bb.
  • The cross is shown in the punnett square.

4 0
3 years ago
Describe Milgrams' study in detail. What factors made obedience more likely?
ValentinkaMS [17]

Milgram found that subjects were more likely to obey in some circumstances than others. Obedience was highest when: Commands were given by an authority figure rather than another volunteer. The experiments were done at a prestigious institution.

8 0
2 years ago
Other questions:
  • The condition on Earth billions of years ago.
    11·1 answer
  • Which of the following is a bacterial disease?
    7·1 answer
  • Help.. Psychological drug dependence means that
    10·1 answer
  • A wax is composed of glycerol and three fatty acids. <br> a. True <br> b. False next
    8·1 answer
  • Water and dissolved mineral nutrients enter the plant's vascular tissue extracellularly through the
    13·2 answers
  • After 8 weeks on the different diets, the scientists collected the following data on the two groups of mice:
    5·1 answer
  • CCC Structure and Function This plant cell has been sliced in half and you
    5·1 answer
  • Does heating a cup of water allow it to dissolve more sugar? Tempature if the water is measured in degrees centigrade. Amount of
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • 4. Briefly state four effects of high humidity on<br>living organisms​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!