Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Answer: Explanation: Cellular respiration is the chemical reaction in which glucose and oxygen are turned into water, carbon dioxide, and energy (ATP). ... C 6 H 12 O 6 + 6 O 2 --> 6 CO 2 + 6 H 2 O + ATP is the complete balanced chemical formula for cellular respiration.
Explanation:
Answer:
A) A tentative statement used to guide a scientific investigation is called scientific hypothesis.
As hypothesis is a proposed details of a phenomena, it can guide us in one way or another to carry out the scientific investigation.
B) Makes prediction about future events is scientific hypothesis.
Scientific hypothesis bases on the observation made predicts about future events, which could be either true or false.
C) Can be tested many independent researches is a scientific theory.
A scientific theory is developed when it has been passed through many researches and had gained acceptance too.
D) Both Scientific theory and hypothesis are based on the observations of the natural phenomena.
Firstly, an observation is made based on natural phenomena, which leads to questions, then research or study is carried out to answer these questions leading to the formation of a hypothesis which upon successful testing forms a theory.
E) Scientific theory is a well-established highly reliable explanation.
It a highly sustained explanation based on facts of nature, that are confirmed via a lot of experiments.
Answer:
6.7 minutes
Explanation:
In a solid such as rock, the primary wave can travel at 5 km/sec; it would take 400 seconds, or about 6.7 minutes to travel 2,000 km.