1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marta_Voda [28]
3 years ago
14

A nurse suspects that the iv line through which doxorubicin (adriamycin) is infusing has infiltrated. the nurse has discontinued

the iv site. what additional action should be taken?
Biology
1 answer:
Ainat [17]3 years ago
6 0
A nurse suspects that the IV line through which Doxorubicin (adriamycin) is infusing has infiltrated. The nurse has discontinued the IV site.
The nurse should IMMEDIATELY APPLY ICE PACK TO THAT AREA. Ice pack helps to reduce the absorption of the drug doxorubicin and thus minimize the its effect.
You might be interested in
Captive-bred trout reduce the fitness of wild populations, Relative fitness Wild Captive Captive Wild Wild Captive What statemen
N76 [4]

Answer:

A) The gene flow between hatchery-reared and wild populations is leading to a decline in fitness of wild populations.

Explanation:

<u>we have relative fitness at its greatest in trouts whose parents are wild x wild. crossing the wild with hatchery reared causes a decrease in the fitness of the troutgene flow is the exchange of genes between two different breeds. the wild is a greatly diverse breed and it is highly adaptive. while the hatchery reared is less adaptive.when these two breed less fit alleles will then be transferred to the wild</u>

therefore option a answers the question

8 0
3 years ago
Which of the following best explains the role of a genetic counselor? to order specific medical tests and prescribe medications
vitfil [10]

The right option is; to develop family pedigrees and inform clients of possible options.

Genetic counselors are trained specialists and part of the health care system that determine possible risk factors of hereditary disorders in patients. They function by analyzing patient histories (pedigree), providing genetic testing and diagnosis, performing genetic risk calculations, counseling and educating patients and their families about potential health risks and available options.

4 0
4 years ago
The worlds greatest garbage crew that eats oil spills, snippets of dna
Elena L [17]

Answer: bacteria

Explanation:

Bacteria can feed on oil spills, snippets of DNA, cell sugars, and possible everything you can think of. Bacteria is very harmful, but some can be helpful. Even though, the answer should be bacteria.

3 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
What is the benafit of scientist using tissue culture to study treatments for cancer patients
andreev551 [17]
The answer is (patients do not receive harmful or ineffective medivatikn 
<span />
7 0
3 years ago
Other questions:
  • 15
    12·1 answer
  • 7. Environmental factors that can contribute to our epidemic of obesity include all of the following except? A. portion sizing B
    10·2 answers
  • Which of the following are the raw materials of photosynthesis? A carbon dioxide and oxygen B carbon dioxide and water C glucose
    10·1 answer
  • Two scientists do not agree on which type of grocery bag is better for the
    11·1 answer
  • Which best describes how sediment forms? A. Loose material is compacted by pressure. B. Chemical changes cause sediment to cemen
    9·2 answers
  • A geologist discovers a sample of fine-grained rock made up of very small crystals. Based on its physical appearance, what can t
    13·1 answer
  • What molecule is needed for photosynthesis to occur? A. nitrogen B. oxygen C. glucose D. carbon dioxide QUICK PLEASE HELP!
    9·2 answers
  • What happens to air mass due to temperature?
    10·1 answer
  • Why do you seldom see fossils in metamorphic rocks?
    15·1 answer
  • An obstruction in the glomerulus would affect the flow of blood into the:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!