1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Serhud [2]
3 years ago
5

Mutations are important for evolution because they _____.

Biology
2 answers:
Alex17521 [72]3 years ago
6 0
They are the source of new genetic variation
Stels [109]3 years ago
6 0

Answer:

are the source of new genetic variation

Explanation:

The concept of mutation is related to the modification of genetic material. Any kind of change, be it in the organization or in number, will result in a new genotype and character.

The importance of mutation lies in the fact that it is precisely that that guarantees the modifications of species, since it is only through a mutation that new genes can emerge. This is why mutations are important and considered the basis for the evolution of species in all populations.

You might be interested in
A patient will be taking amiodarone [cordarone]. which baseline tests are necessary before this medication is started? (select a
olga55 [171]
Upon researching, I believe the choices are:

<span>A. Chest radiograph and pulmonary function tests
B. Complete blood count with differential
C. Ophthalmologic examination
D. Renal function tests
E. Thyroid function tests
</span>
Among these, the baseline tests necessary for the patient before taking the medication are: A. Chest radiograph and pulmonary function tests, C. Ophthalmologic examination, and E. Thyroid function tests. This is because Amiodarone has several possible toxic side effects. Some of these are thyroid toxicity, opthalmic effects, and pulmonary toxicity. Thus, it is necessary to first know the baseline of the patient for these systems and then checking if the results have deviated much after he/she takes the medication.  
5 0
3 years ago
Read 2 more answers
How does the fertilization process produce diploid cells?
djyliett [7]
Most cells in the body are diploids, germ line diploid cells will undergo meiosis to produce gametes. Fertilization following, the gametophyte phase is haploid and the part of the life cycle in which gametes are produced by mitosis of haploid cells.



Hope this helps!!!!
3 0
3 years ago
Which statement best distinguishes stem cells from other body cells?
Yakvenalex [24]

Answer:

Explanation:-All stem cells from a given organism contain the same genome. -All stem cells have the capacity to differentiate into specialized cell types. -Stem cells replenish our skin cells and red blood cells.  i hope this helps

6 0
3 years ago
A cereal box has a height of 32 centimeters. It has a
xxMikexx [17]

Answer:

Yes this is correct. 160, the base, times 32, the height, equals 5120 cubic centimeters

4 0
2 years ago
FIll in the blanks PLEASE HELP I NEED IT NOW! YOu will get 20 POINTS!
marta [7]
I’m pretty sure the first one is weathering and the second one is deposition
8 0
3 years ago
Other questions:
  • A scientist was observing a specimen under a microscope. He obtained the specimen from pond water. He observed that the specimen
    10·1 answer
  • 2. Cross a homozygous two horned zork with a heterozygous two horned
    15·1 answer
  • Winds always blow from ________ pressure toward _______ pressure, and they curve because of the _______ effect.
    7·2 answers
  • What is the definition of hypertonic
    5·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Using the image what organelle is E
    7·1 answer
  • Bioinformatics can
    13·1 answer
  • Plants make food through photosynthesis, a chemical reaction.
    12·2 answers
  • Density is mass per unit of volume which pair of lab instruments would a student use to measur the density of sea water
    13·1 answer
  • What is the relationship between the ETC and oxygen?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!