1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
4 years ago
12

The nurse is caring for a client on a patient-controlled analgesia (pca) pump. what additional interventions by the nurse would

be effective for pain relief? select all that apply.
Biology
1 answer:
zysi [14]4 years ago
4 0
<span>Answer: Correct1 Ask the client to tell the purpose of the PCA device. Correct2 Emphasize that client controls medication delivery. Correct3 Explain that the pump prevents the risk of overdose. 4 Tell family members to operate the PCA device for the client. 5 Teach the use of PCA after the client awakens from sedation. The nurse should teach the client about PCA and evaluate the client's understanding by asking the client to explain it back. The client should be the one controlling the administration of the medication based on the pain. It is programmed in a way to prevent overdose. The family members should not operate the PCA device for the client because the dose depends on the pain perception by the client. The client should be taught the use of the device before the procedures so that when the client awakens from sedation, the client can administer the analgesia.</span>
You might be interested in
What happens during metaphase.
Butoxors [25]

Answer: During metaphase, the cell's chromosomes align themselves in the middle of the cell through a type of cellular "tug of war." The chromosomes, which have been replicated and remain joined at a central point called the centromere, are called sister chromatids.

Explanation:

6 0
3 years ago
Read 2 more answers
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
what is an important principle of the scientific method in which an experiment can accurately be reproduced by an independent re
azamat

Answer:

Replication

Explanation:

Replication is the ability of an essay or experiment to be reproduced or replicated by others, in particular, by the scientific community. Replication is one of the pillars of the scientific method, with falsifiability being the other. Depending on the particular scientific field, reproducibility may require that the test or experiment be falsifiable.

6 0
3 years ago
In the scientific world, cold hard facts are often termed _____.
user100 [1]
The correct answer to go in the blank would be ''laws''.
3 0
3 years ago
Read 2 more answers
A biologist studying a desert ecosystem observes that the population of a lizard species increases following a particularly hot,
bekas [8.4K]
Based on the description of events, being that the lizard population appears to increase as soon as the snake population decreases, it appears that the snakes prey on the lizards. This suggests that the snake is a keystone species. A keystone species is one that has a dramatic effect on maintaining the balance of an ecosystem. As soon as the snake population decreases, major changes occur to the ecosystem, such as the lizard population increasing.

Therefore, the answer is D: <span>The snake is a keystone species in the ecosystem.</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • An increase in Earth’s average temperature due to the buildup of carbon dioxide and other gases in Earth's atmosphere is called
    5·1 answer
  • What impact might the increasing worldwide use of the internet have on the final step of the experimental method?
    14·1 answer
  • What percentage of energy is transferred when a mouse is eaten by a fox? 90% 0% 10% 100%
    14·1 answer
  • Trenches in the ocean are
    13·1 answer
  • Can some one help me with the natural science lab report it’s on Darwin’s theory with the different gallapos beak size, I will g
    8·1 answer
  • Who suggested the sun and the moon orbited earth, and the rest of the planets orbited the sun
    12·1 answer
  • In the table above all organisms have
    14·1 answer
  • Psychology as a science <br><br> Which of these shows no correlation?
    7·2 answers
  • Order the steps of the urine formation process
    9·1 answer
  • What happens when a cold front replaces a warm front
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!