All categories

3 years ago

What class of cells are bacteria apart of

Biology

2 answers:

lana66690 [7]3 years ago

8 0

They are prokyartic cells

AysviL [449]3 years ago

4 0

Prokaryotes. Bacteria, as prokaryotic cells, lack these internal membrane-bound structures.

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

What causes oxygen to diffuse from the lungs into the capillaries?

malfutka [58]

Answer:

Inside the air sacs, oxygen moves across paper-thin walls to tiny blood vessels called capillaries and into your blood. A protein called haemoglobin in the red blood cells then carries the oxygen around your body.

Explanation:

Hope this helps

3 0

3 years ago

HELP PLS ASAP!! I need this in an hour and 30 mins!<br>Ps. Have a lovely day

strojnjashka [21]

Hii basically ive included a photo of what it should look like
Good luck!!

8 0

1 year ago

DNA contains instructions for making the different molecules, such as proteins, that a cell needs to grow and function. To use t

ohaa [14]

Answer:

C. transcribed, mRNA

Explanation:

DNA, also known as deoxyribonucleic acid, is a molecule that holds genetic information needed to make other molecules in living organisms. However, before this genetic information can be harnessed, it needs to be expressed via two processes called transcription and translation.

Transcription is the first of the two processes that take place during genetic expression. It involves the synthesis of mRNA molecule from a DNA template. In other words, the DNA must first be TRANSCRIBED into mRNA.

3 0

3 years ago

In 3-5 sentences, explain why the saying, “you are what you eat” is factually correct.

soldi70 [24.7K]

Answer:

When ingesting a substance, it has it's own unique effect on our body, for better or worse. For example, take a greasy food, such as french fries. It shoots our cholesterol way up, bring the fat content in our bodies up. Therefore, we truly are what we eat, we eat healthy, we'll be healthy, we eat unhealthy, our bodies will be unhealthy.

Explanation:

7 0

3 years ago