1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
12

Explain why the cane toad was a failure as a biological control method in Australia.

Biology
1 answer:
kakasveta [241]3 years ago
7 0
The cane toad was a failure as a biological control method in Australia because:
-The greyback beetle it was supposed to be eating fed at the top of the sugarcane stalks (which were 6-8 meters in height). Cane toads cannot fly or climb and therefore couldnt feed on the beetles.
-The beetles were out during the daytime, and cane toads feed at night.
-The two species are not seasonally compatible (aren't in the same place at the same time of year).
-The toads needed moist conditions to survive, and so moved away from where they were supposed to be.
-The cane toad eats many native species and often out-competes native species for food and breeding sites, leading to the decline of natives.
-Breeding habits made the cane toads a very invasive species.
You might be interested in
Describe the relationship between tissues and organs
soldier1979 [14.2K]
An organ is made of tissues. A tissue is made from multiple cells that carry out the same function, For example : a cardiac muscle is made from many cells of the same type. An organ whereas is made from group of tissues which have similar structure and functions.
I hope this helps.
8 0
3 years ago
Which of the following is an example of a scientific theory?
KATRIN_1 [288]

Answer:

a There is probably life on Mars.

Explanation:

A scientific theory is basically an opinion that has not been proved or disproved yet.

All of the other options are true science-backed facts.

<em>Hope this helps! Please let me know if you need more help, or if you think my answer is incorrect. Please rate and click the Thanks button if it helped you out. Brainliest would be MUCH appreciated. Have a great day!</em>

<em>Stay Brainy!</em>

<em>−</em><em>Kallmekrish</em>

<em>The future belongs to those who believe in the beauty of their dreams.</em>

<em>- Eleanor Roosevelt, Former U.S. First Lady</em>

7 0
3 years ago
mutation that increases the ability to store moisture in a dry environment is harmful beneficial or neutral
RUDIKE [14]
Beneficial, because increased ability to store moisture in a dry environment is helpful for the organism.
3 0
3 years ago
What objects could you use to set up a still life?
Alja [10]

Answer:

I think it's D

Explanation:

i am not really sure

7 0
2 years ago
Read 2 more answers
What are some ways to ruse different types of paper so it does not end up in garbage?​
PilotLPTM [1.2K]
You can use old pieces of paper as scratch paper, make papier mache, use it as padding for packages, or make origami.
5 0
3 years ago
Other questions:
  • Which must a animal do for cellular respiration to begin?
    11·1 answer
  • I need the answer to these two questions please!
    10·1 answer
  • The table of neoplasms is located in the
    8·1 answer
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Mold fossil                 formed when remains trapped tree sap
    7·2 answers
  • Which sets of data show a wave with the shortest wavelength?
    9·2 answers
  • Why are mitochondrion called the powerhouse of the cell
    8·1 answer
  • What is the amount of starlight received on earth​
    13·1 answer
  • LUUL<br> 18. Gametes are produced during
    9·2 answers
  • According to science,death is as a result of the aging of the cells. But death occurs at any stage in life, at one month, a year
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!