Here is the answer of the given question above.
Often times, non-human life in an urban ecosystem is more disturbed in a way that changes happen rapidly, such as the soil and plant cover and temperature and water availability. In this kind of ecosystem, there is no stability and sustainability. On the other hand, in an undeveloped forest ecosystem, plants play a major role and that, the lives in this kind of ecosystem is undisturbed, making it more ideal for many animals to live. Hope this answer helps.
The answer should be photosphere zone.
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Answer:
<em>When the rod cells become more involved, affected individuals experience a decreased ability to see at night or in low light situations and may lose the ability to see clearly to the sides </em>
