DNA:GCTAGCAG
RNA:CGAUCGUC therefore, C is the correct answer.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
The answer is A.<span> the water would all be trapped in the atmosphere. </span>
Volume the volume of the test tube is approximately 35cm so the water is 20m/cw idk if this helps
This colored pigment is known as Hemoglobin. Hemoglobin is contained in the red blood cells of vertebrates and gives these cells their red color.
