MRNA is produced which caries the sequence to produce proteins
It should be
AGATACCATGGTTACCCGGTTCCA
White blood cells. hope that helped
Answer:
D. Crossing<em> over occurs after replication and only sister chromatids exchange gene segments to make new combinations of genes.</em>
The answer to the statement above is TRUE. Recently, Permafrost has been seen in the regions of Eurasia and North America even though glaciers are not even common in this area. Normally, permafrosts are found in the polar regions. These are made up of frozen thick subsurface layer of soil that has remained untouched for years.
