1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sav [38]
3 years ago
10

Which is the final electron acceptor in the electron transport system of cellular respiration?

Biology
2 answers:
saveliy_v [14]3 years ago
7 0

Oxygen is the answer

Volgvan3 years ago
3 0
Your answer would be, oxygen
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Many bedbugs are highly resistant to insecticides, but the scientist’s bedbugs aren’t resistant. Explain why this happens based
Nutka1998 [239]

Wild Bedbugs become insecticide resistant because of the mutations and natural selections.

<h3><u>Explanation</u>:</h3>

As the huge amount of pesticides and insecticides are sprayed in the rooms for cleaning, the pests and insects like bedbugs dies in huge portions because of the toxin. But some of the bedbugs remain alive as they have mutations that help them to detoxify the toxins given, or bypass the metabolic processes so that the toxins don't hamper them much.

Now as the population becomes very small(bottle neck effect), the nature selects these organisms over the other to propagate more sufficiently and enormously. As the nutrients and supplies are also available, so the bedbugs don't suffer any lack of nutrition which can be a determining factor of their population.

Thus the wild bedbugs become resistant to insecticides while the experimental one remain succeptible to insecticides.

4 0
3 years ago
Which term refers to a group of organisms that are known to be discontinuous with each other?
hammer [34]

The Term is called Niche Full distance of physical and biological setting in which an organism lives and the way in which the organisms uses those conditions. Causing species to divide resources, competition helps determine the number and kinds of species in a community and the niche eacthcies occupies.

<span> </span>

5 0
3 years ago
Which is NOT part of the cell theory?
atroni [7]

Answer:

B.

Explanation: Hope this helps! ^^

8 0
2 years ago
What kind of mutation does this image represent
rusak2 [61]

Answer:

A. Deletion

Explanation:

5 0
1 year ago
Other questions:
  • In a human karyotype, chromosomes are arranged in 23 pairs. If we choose one of these pairs, such as pair 14, what do the two ch
    11·1 answer
  • 1. Write the part of the brain that performs each of the functions shown below. (2 points) Regulates sleep Connects brain and ey
    13·2 answers
  • What is a example of allele
    13·1 answer
  • Why must an IV solution have salts in it?
    11·1 answer
  • Which compound is not made of molecules? a.C6H1O6 b. CO2 c.H2O d.NaCI
    7·2 answers
  • Of the earth's liquid water, most of the freshwater is stored in the form of ________.
    11·1 answer
  • Someone help pleaseee easy 7th grade work
    9·1 answer
  • Where does the life in the forest start
    13·1 answer
  • 12 Which direction does blood flow in arteries?​
    5·2 answers
  • Which of the following is the most important characteristic that biologists use to classify animals?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!