1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
4 years ago
12

Why are atoms considered the basic unit of matter

Biology
1 answer:
Novosadov [1.4K]4 years ago
6 0
Because they are the smallest units of matter
You might be interested in
What are aves . give two examples.​
horsena [70]

Answer:

Aves is a class of vertebrates that comprises the birds' species.

1. Archiornithes

2. Neornithes

5 0
3 years ago
What happens to a trait when genes combine in different ways?
igor_vitrenko [27]
The dominant gene takes over
7 0
3 years ago
Read 2 more answers
What is the most important requirement for all living things
fiasKO [112]
Carbon since all life requires it
6 0
3 years ago
How many acres of wood is logged annually?
nalin [4]

Answer:

C

Explanation:

5 0
3 years ago
Rivers and streams are biodiverse ecosystems that are sensitive to change.
marin [14]
The answer is B.) False
4 0
4 years ago
Read 2 more answers
Other questions:
  • Explain how human activity, pollution, and acid rain are all related to each other
    7·1 answer
  • Paper chromatography is a technique used to separate molecules based upon their size and solubility in a particular solvent. If
    8·1 answer
  • Which level of cellular organization is the most complex?
    6·1 answer
  • Evidence has been found that shows that primate ancestors developed the ability to see color. Previously, like most mammals, the
    8·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Describe the major steps of cell fractionation and centrifugation and explain why they are useful techniques
    15·1 answer
  • There are 3 types of polar bears: ones with thick coats, ones with thin coats and ones with medium coats. It is fall, soon to be
    13·1 answer
  • Is lichen growing on rocks a mechanical or a chemical
    7·2 answers
  • Plasma in the body is mostly made of what​
    11·1 answer
  • HELPPP ASAP!!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!