1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
3 years ago
8

What is the name of the type of reaction that occurs when two substances join to form a single product?

Biology
2 answers:
Alekssandra [29.7K]3 years ago
4 0

Answer:

Synthesis reaction

Explanation:

hope this helps

SSSSS [86.1K]3 years ago
4 0

Answer:

<h3>synthesis reaction</h3>

Explanation:

A synthesis reaction occurs when two or more reactants combine to form a single product.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
When a limp piece of celery is placed in pure water, the celery becomes crisp
Drupady [299]

Answer:

OA. Osmosis

Explanation:

5 0
3 years ago
Scientists often classify organisms into two
BigorU [14]

Answer:

b

Explanation:

this is because Invasive species are frequently generalists in terms of food, or habitat needs, have fewer predators in their introduced environments and are better able to exploit disturbances than their native competitors.

7 0
2 years ago
la evaluacion de impacto ambiental se puede realizar antes durante y despues de implementar un proyecto​
Katena32 [7]

Answer: do u speak English

Explanation:

6 0
3 years ago
Three of the same species of plant are each grown under a different colored light for the same amount of time. Plant A is grown
professor190 [17]

Answer:

A C B

Explanation:

Chlorophyll pigments absorb most of the light in the blue and red regions. Blue-violet region marks the peak absorption by chlorophyll a while chlorophyll b shows peak absorption in red blue light. Green colored light is not absorbed by chlorophyll a and b. Light absorption by chlorophyll is essential for the light-dependent phase of photosynthesis. Therefore the plant A grown under blue light will show maximum growth and plant B kept under green light would show minimum growth.

6 0
3 years ago
Other questions:
  • What hormone removes glucose from the blood and stores it in the liver?
    6·1 answer
  • Which term refers to the behavior of two species attempting to use the same living space food source and water source?
    8·1 answer
  • What does he lac Operon in bacteria code for
    15·1 answer
  • Which choice is NOT part of the circulatory system?
    5·1 answer
  • A goiter is an enlargement of the thyroid gland that is associated with abnormal thyroid function. the worldwide incidence of go
    13·1 answer
  • The patient was admitted to the hospital with a multitude of gastrointestinal symptoms. after diagnostic tests were performed th
    6·1 answer
  • Human spermatozoa:
    8·2 answers
  • Which outcome is the main function of the light dependent reaction‘s of photosynthesis
    15·1 answer
  • If there are 22 chromosomes in the nucleus of a toad skin cell, a toad egg cell would contain
    6·2 answers
  • Locations in California are warmest in summer because sunlight in summer is
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!