1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lutik1710 [3]
3 years ago
7

According to research, what characteristic is most frequently shared by firms that receive high rankings for corporate social re

sponsibility? encouraging employees to participate in civic activities requiring managers to understand ethics laws promoting integrity through ethics training linking compensation to ethical behaviors
Law
1 answer:
kvasek [131]3 years ago
3 0

Answer:

<h2>Promoting integrity through ethics training. </h2>

Explanation:

Ethics training means training the employees to identify and deal with various types of ethical problems that they face in everyday actions and choices. It is the basis of the long term success.

It allows the employees to maintain productivity and quality, and also allows the organisations to comply with the regulations and the laws.

Above all it ensures proper and good relationships with the vendors and customers. Ethics training can also help to teach employees about integrity.

You might be interested in
Identify, discuss, and resolve the conflict between the right to free speech and the government’s regulation of the practice of
vfiekz [6]
The freedom of speech and of the press, and the right of the people peaceably to assemble and consult for their common good, and to apply to the government for redress of grievances, shall not be infringed

In the United States, freedom of speech and expression is strongly protected from government restrictions by the First Amendment to the United States Constitution, many state constitutions, and state and federal laws.
5 0
3 years ago
QUESTION 2
Sauron [17]

Answer: Executive orders

Explanation:

One of the powers that comes with being the Head of the Executive branch of government is the power to issue Executive orders. Executive orders are binding to the officers and agencies under the Executive branch as they are under the President.

Executive orders are to be treated as legislation with the full weight of the law. They are still subject to Judicial Review however, to ensure that the President is not issuing orders that contravene the Constitution.

6 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Question 7 (1 point)
Keith_Richards [23]

Answer:

Explanation:

4 0
2 years ago
How can the judiciary balance individual rights with the common good?
Lady bird [3.3K]

Answer:

In simple words, In order to reconcile human rights with both the common interest, the courts must determine each circumstance on a scenario-by-case basis, bearing into consideration democratic values, existing statutes and previous Supreme Court and other tribunals decisions.

In America, our Constitution and other founding documents grant certain human freedoms or civil liberties. America's founders, including Thomas Jefferson as well as James Madison, intentionally placed these freedoms throughout the Bill of Rights because the government might consider it quite challenging to abrogate them.

7 0
3 years ago
Other questions:
  • Is a way to minimize technical problems with your computer.
    11·1 answer
  • 6. Who constitutes the collective body of the Joint Chiefs of Staff? (1 point)
    14·2 answers
  • What is a litigation
    5·1 answer
  • What is love and how do u know if its real ????
    15·2 answers
  • 3. What is a Juror ?
    9·1 answer
  • Tools
    12·1 answer
  • Is Your mom gay is he tell me tell me or his he tell me tell meeee
    13·1 answer
  • Workplace murders are most commonly committed by offenders in which age group? O a . Under 18 O b . 18-24 O c . 25-34 O d 35-49
    8·1 answer
  • A loan with an initial fixed interest rate that then becomes variable?
    13·1 answer
  • Importance of personal identification in the crime investigation
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!