1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
2 years ago
14

Suppose you look at a microscope to look at a cell from leaf of a tree.What structure will you see that would not be found in a

cell from you finger nail.
A)cilia
B)mitochondria
C)ribosomes
D)chloroplasts
Biology
1 answer:
KatRina [158]2 years ago
4 0
Chloroplasts (they are only present in plants)
You might be interested in
In humans (and other animals) where does glucose come from?
Maru [420]

Answer:

Glucose is a carbohydrate, and is the most important simple sugar in human metabolism. ... Glucose is one of the primary molecules which serve as energy sources for plants and animals. It is found in the sap of plants, and is found in the human bloodstream where it is referred to as "blood sugar"

Explanation:

5 0
2 years ago
Read 2 more answers
Why are three-dimensional models useful for understanding the lunar phases?
Juli2301 [7.4K]
New moon, quarter moon, full moon are what we call the lunar phases. These are consequences of the motions of the Sun, Earth and moon. Three dimensional models are useful because the face of the moon that catches the light of the Sun depending on their position at any given time could be depicted well. Circular models would be the best visuals for the lunar phases.
7 0
3 years ago
A controlled experiment was conducted to analyze the effects of darkness and boiling on the photosynthetic rate of incubated chl
Bond [772]

Answer:

where's your data? tho, i think we're answering the samee thingggg. here's mineee

7 0
2 years ago
Which of these is NOT a type of fungi?<br><br> yeast<br><br> mold<br><br> algae<br><br> mushrooms
Angelina_Jolie [31]

Answer: Algae

Explanation:

Algae

Algae are grouped in the kingdom Plantae. The unicellular blue-green algae are kept under the kingdom Protista

Fungi

In the five-kingdom classification by Whittaker, fungi were placed in a separate kingdom Fungi

7 0
3 years ago
¿Qué incluye la industria de Plantas Ornamentales?
tangare [24]

Answer:

Floriculture is an international, multi-billion dollar industry that includes the production of bedding and garden plants, foliage plants, potted flowering plants, cut flowers, cut cultivated greens, and floriculture materials.

Explanation:

6 0
3 years ago
Other questions:
  • What happened as the John Travoltage moved his finger farther away from the door knob?
    13·2 answers
  • Which of the following colors of soil is the best for a wildlife habitat
    6·2 answers
  • The word carbohydrate is derived from carbon and water (hydrate). explain why this combination correctly describes this chemical
    12·1 answer
  • Which area has the greatest elevation difference?
    11·2 answers
  • What is the name of the continent, name of the largest city, geographic feature.
    10·1 answer
  • Foods that allow microorganisms to grow are called parasites. TRUE or FALSE
    10·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Due to the fact that ice is less dense than water inrits liquid form Select one:
    5·1 answer
  • Please help me with put the examples in the right categories
    10·1 answer
  • Sam wished to investigate how fertilizer
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!