1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
5

In photosynthesis, water undergoes ______ while carbon dioxide undergoes ________

Biology
1 answer:
Dovator [93]3 years ago
5 0
A,
oxidation is when a molecule loses electrons.
<span>in this case, water is losing an electron and CO_2 is gaining an electron, which then makes it an energy rich sugar molecule</span>
You might be interested in
Cell requlation doesn't seem to work in patients with
sweet-ann [11.9K]

Answer: I think it's heart disease

Explanation:

4 0
3 years ago
Which action is a reflex action? A. asking for coffee in a cold climate B. blinking when light is flashed in the eyes C. drinkin
Natalka [10]

the answer is b: blinking when light is flashed in the eyes


4 0
3 years ago
Read 2 more answers
This question deals with common misconceptions about what Hardy-Weinberg equilibrium (HWE) is. In peas, flower color is controll
butalik [34]

Answer:

I cant understand this question. Can u help?

Explanation:

7 0
2 years ago
Hemoglobin buffers the pH of the cytosol of RBC by combining with ______ions.
jarptica [38.1K]

Answer:

H+

Explanation:

Hemoglobin is the major protein of red blood cells. It has many exposed amino groups and carboxylic groups at its surface. These NH3 and COOH groups serve as weak acids and bases respectively and allow hemoglobin to serve as a buffer to maintain the pH of the RBC cytoplasm.

As the exposed amino groups of hemoglobin protein bind to the H+ ions, the free H+ concentration of the cytoplasm of RBC is reduced leading to a buffer action to maintain the pH.

6 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • The cartilage on the ends of long bones serves which of the following functions? *
    8·1 answer
  • Interpret qualitative and quantitative data from undisturbed and disturbed ecosystems, communicate the results graphically, and
    5·1 answer
  • A mite is a tiny organism that may ride on top of an insect, such as a beetle, in order to move quickly from place to place. The
    14·2 answers
  • What property allows
    8·1 answer
  • Which statement best describes energy entering the living world?
    7·2 answers
  • Where does transcription take place in eukaryotic cells
    15·1 answer
  • Which changes the litmus paper to red
    5·1 answer
  • What are gametes?
    9·2 answers
  • Why is freshwater important, why is it at risk, and what actions can we take to protect it?
    9·1 answer
  • How do i write an email to apply for university
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!