1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SSSSS [86.1K]
3 years ago
10

The belief that children's immune systems need to be exposed to viruses and bacteria in order to strengthen them, but that child

ren are overprotected from this exposure, is called the _____.
Biology
1 answer:
Fudgin [204]3 years ago
6 0
This belief is called the hygiene hypothesis which is not completely valid and tested as truth and applicable to all cases. This states that once a child is exposed more to viruses and bacteria, the child becomes immune to sicknesses. Of course, this takes all the factors to play to determine the index of a child's immunity to illnesses.
You might be interested in
You are examining a field of crop plants and notice that many of the leaves have small scattered necrotic spots on them, but non
Thepotemich [5.8K]

Answer:

Avirulent.

Explanation:

VIRULENCE is the ability of a pathogenic organism  to infects the host, leading to damages  or death of the host. The extent of these virulent effect depends on  certain chemical substances ( called Virulence factors) produced during the  pathogenic processes.

The virulence effects  is achieved  due to the ability of the virulent factor to disrupt the entire physiological mechanisms of  the organisms; e,g crop plants; though  suppression of the host immune response, disruptions of the immune mechanisms, colonization of the host DNA structure etc. Therefore the pathogenic effects suppressed the host resistance and spread throughout the host body system.

In this present scenario, the pathogenic effect of the likable bacteria; is not virulent, because

none of the d crop pant is completely diseased.

the nascent intenodes and leaves  are growing to usual size.

Consequently, the physiological and the morphological features of the crop plants are still intact. Thus the infection is AVIRULENT.

8 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Air sacs and pneumatic bones are seen in ______​
ryzh [129]

Answer:

Birds have remarkably specialized bones that are pneumatic, because they are full of air sacs that provide a continuous flow of breath throughout their bodies. In short, their lungs are essentially hooked up to their bones.

4 0
2 years ago
Read 2 more answers
How do sexual reproduction produce new plants?
gavmur [86]

Sexual reproduction in flowering plants involves the production of male and female gametes, the transfer of the male gametes to the female ovules in a process called pollination. After pollination occurs, fertilization happens and the ovules grow into seeds within a fruit.

8 0
2 years ago
Explain the function of the chloroplast.
QveST [7]

Answer:

In particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules.

Explanation:

Hope this helps you

Crown me as brainliest:)

5 0
3 years ago
Read 2 more answers
Other questions:
  • Which part of the brain plays a major role in homeostasis by regulating such processes as heart rate and breathing through the a
    15·1 answer
  • Ionic compounds dissociate in water into?
    13·2 answers
  • Peppered moths come in two colors, black and white. What did Kettlewell show, with regard to peppered moth populations and tree
    8·1 answer
  • Which best describes the role of a primary consumer in a food web?
    7·1 answer
  • Which is true of all crops that humans grow
    5·2 answers
  • Which states of water can u find in your home
    6·1 answer
  • This type of asexual reproduction occurs when a single celled organism divides into two organisms.
    11·2 answers
  • Which organic compound produced during photosynthesis is used by plants to store energy?
    11·1 answer
  • Jackson lives near the equator. Nighttime for Jackson is _
    12·1 answer
  • PLEASE HELP 40 POINTS!!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!