Answer:
Avirulent.
Explanation:
VIRULENCE is the ability of a pathogenic organism to infects the host, leading to damages or death of the host. The extent of these virulent effect depends on certain chemical substances ( called Virulence factors) produced during the pathogenic processes.
The virulence effects is achieved due to the ability of the virulent factor to disrupt the entire physiological mechanisms of the organisms; e,g crop plants; though suppression of the host immune response, disruptions of the immune mechanisms, colonization of the host DNA structure etc. Therefore the pathogenic effects suppressed the host resistance and spread throughout the host body system.
In this present scenario, the pathogenic effect of the likable bacteria; is not virulent, because
none of the d crop pant is completely diseased.
the nascent intenodes and leaves are growing to usual size.
Consequently, the physiological and the morphological features of the crop plants are still intact. Thus the infection is AVIRULENT.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Birds have remarkably specialized bones that are pneumatic, because they are full of air sacs that provide a continuous flow of breath throughout their bodies. In short, their lungs are essentially hooked up to their bones.
Sexual reproduction in flowering plants involves the production of male and female gametes, the transfer of the male gametes to the female ovules in a process called pollination. After pollination occurs, fertilization happens and the ovules grow into seeds within a fruit.
Answer:
In particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules.
Explanation:
Hope this helps you
Crown me as brainliest:)