Answer: The correct answer is- D certain factors are dominant and other factors are recessive.
Mendel was interested in knowing the offspring that is produced from the cross pollination (that is from two different plants) as he wanted to study different traits of pea plant.
For doing so, he first removed the anthers of one plant (to prevent self pollination) and then transferred the pollens of one plant into the stigma of another plant.
When he allowed the cross pollination of purebred pea plant with other plant, he observed that some factors are dominant (such as tall height of pea plant, which masks the expression of recessive factors) and other are recessive (such as dwarf height of pea plant).
Thus, option D) is the right answer.
Answer:
Explanation:
Pharmacophore (pharmacology) - The molecular framework responsible for a drug's biological activity. According to IUPAC — A pharmacophore is the ensemble of steric and electronic features that is necessary to ensure the optimal supramolecular interactions with a specific biological target structure and to trigger (or to block) its biological response.
Privileged structures are defined as molecular frameworks which are able of providing useful ligands for more than one type of receptor or enzyme target by judicious structural modifications.
1) The 1,4-dihydropyridine ring is present in many biologically important molecules that acts as an important scaffold for cardiovascular drug - a calcium antagonists and although it is technically not considered as a pharmacophore, it is considered as a privileged structure.
1,4-Dihydropyridine (DHP), belongs to the class of calcium antagonist that inhibits the influx of extracellular Ca+2 through the L-type voltage-dependent calcium channels.
A positional substitution in the 4-position is feasible in the heterocyclic ring which in turn culminates in various calcium channel antagonist activities and this heterocyclic ring is the common feature for various pharmacological activities such as anti-inflammatory activity, analgesic activity,
antihypertensive, antianginal, antitumor, antitubercular activity and antithrombotic .
Position on the heterocyclic ring binds to the L-type channel and also to N-type channel on membranes.
2.) The bioisosteres are not a suitable bioisostere for the traditional C-4 aryl or heteroaryl substitution which is necessary for calcium ion blockage thereby inhibiting it to function with the mechanism shared above.
Answer:pencil life cycle is way different because as you know they make pencils from wood which is trees so they have to grow the trees first.
Explanation:
Answer:
Active transport
Explanation:
To transport the substrate across the membrane it will need energy in the process it's called active transport.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: