1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashcka [7]
3 years ago
11

When you wrinkle your eyebrows together as you concentrate on your quiz in class, the muscle that is pulling the eyebrows togeth

er and creating the vertical wrinkle around the nose is the?
Biology
2 answers:
n200080 [17]3 years ago
3 0
The corrugator supercilii is a small, narrow, pyramidal muscle close to the eye. It is located at the medial end of the eyebrow, beneath the frontalis and just above orbicularis oculi muscle. ... The name corrugator supercilii is Latin, meaning wrinkler of the eyebrows.
Tell me if it helps..
love history [14]3 years ago
3 0

Answer:

Procer muscle also called pyramidal muscle of the nose, is located towards the nasal bone. It is the muscle that moves when the frown is frowned, this movement creates transverse wrinkles superior to the bridge of the nose, the hero pulls the medial margin of the lower eyebrows.

It helps create facial expression of anger and concentration.

You might be interested in
What did Mendel's cross pollination of pea plants prove
pashok25 [27]

Answer: The correct answer is- D certain factors are dominant and other factors are recessive.

Mendel was interested in knowing the offspring that is produced from the cross pollination (that is from two different plants) as he wanted to study different traits of pea plant.

For doing so, he first removed the anthers of one plant (to prevent self pollination) and then transferred the pollens of one plant into the stigma of another plant.

When he allowed the cross pollination of purebred pea plant with other plant, he observed that some factors are dominant (such as tall height of pea plant, which masks the expression of recessive factors) and other are recessive (such as dwarf height of pea plant).

Thus, option D) is the right answer.

4 0
3 years ago
Read 2 more answers
Based on the definitions of pharmacophore and privileged structure, outline essential structural features a 1,4-dihyrdopyridine
stiv31 [10]

Answer:

Explanation:

Pharmacophore (pharmacology) - The molecular framework responsible for a drug's biological activity. According to IUPAC — A pharmacophore is the ensemble of steric and electronic features that is necessary to ensure the optimal supramolecular interactions with a specific biological target structure and to trigger (or to block) its biological response.

Privileged structures are defined as molecular frameworks which are able of providing useful ligands for more than one type of receptor or enzyme target by judicious structural modifications.

1) The 1,4-dihydropyridine ring is present in many biologically important molecules that acts as an important scaffold for cardiovascular drug - a calcium antagonists and although it is technically not considered as a pharmacophore, it is considered as a privileged structure.

1,4-Dihydropyridine (DHP), belongs to the class of calcium antagonist that inhibits the influx of extracellular Ca+2 through the L-type voltage-dependent calcium channels.

A positional substitution in the 4-position is feasible in the heterocyclic ring which in turn culminates in various calcium channel antagonist activities and this heterocyclic ring is the common feature for various pharmacological activities such as anti-inflammatory activity, analgesic activity,

antihypertensive, antianginal, antitumor, antitubercular activity and antithrombotic .

Position on the heterocyclic ring binds to the L-type channel and also to N-type channel on membranes.

2.) The bioisosteres are not a suitable bioisostere for the traditional C-4 aryl or heteroaryl substitution which is necessary for calcium ion blockage thereby inhibiting it to function with the mechanism shared above.

6 0
3 years ago
Identify one effect each step of the pencil's life cycle may have on society or the
Y_Kistochka [10]

Answer:pencil life cycle is way different because as you know they make pencils from wood which is trees so they have to grow the trees first.

Explanation:

3 0
2 years ago
Read 2 more answers
It is to transport of two substrates in the same direction across the membrane.
RSB [31]

Answer:

Active transport

Explanation:

To transport the substrate across the membrane it will need energy in the process it's called active transport.

8 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • A point mutation changes the Dna sequence cga to cgt but the same protein is produced which point mutation occured
    11·1 answer
  • Lil billy ate 600 cookies in under 44726762755427475452 seconds . How many hours did this take?
    14·2 answers
  • Why are insects important for flowering the plants ?
    12·1 answer
  • Each organism in a population produces more offspring than can survive. This is called .
    5·1 answer
  • What is the importance of feedback signals at key checkpoints within the cell cycle?
    12·1 answer
  • If i want to be a genecist is it necessary that i take maths in 11 and 12 class?
    6·1 answer
  • This tortoise is eating cactus on a sunny day. Is carbon moving into the air, moving
    11·1 answer
  • What evidence shows that biological molecules on earth form naturally?
    14·1 answer
  • Which two organisms are able to form a symbiotic relationship with each other
    10·1 answer
  • George wants to know which flower, a carnation or a rose, is more beautiful. he surveys his classmates to gather data. why is th
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!