1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
4 years ago
15

How can biologists save lives

Biology
1 answer:
wlad13 [49]4 years ago
4 0
By studing the dieses or problems with the patients

You might be interested in
Can someone help please
vivado [14]
I think the answer is A.
8 0
3 years ago
The fossil record indicates that the earliest hominids most likely originated on which continent?
Brums [2.3K]
The fossil record indicates that the earliest hominids most likely originated in "Africa," since this is the location from which humans eventually migrated to other locations.
7 0
3 years ago
Is dehydration an example of anabolism or catabolism?
allochka39001 [22]

dehydration is an example of anabolism.

8 0
3 years ago
Passive transport can be explained by which
Sedaia [141]

Answer:

It must be large particles move into cells, unless there is another option

Explanation:

Passive transport does not require energy, so the first one is incorrect

Particles are moved from areas of high concentration to an area of low concentration, so the last one is also incorrect

So it should be large particles can move into cells, unless of course there is another option

7 0
3 years ago
A segment of dna that codes for the ability to make one type of protein molecule is known as a(n)____________________.
tatiyna
The answer that describes the sentence above in which is a segment of DNA that are being coded in means of making one type of protein molecule is known as the gene. The gene is considered to be a unit that is physical and function responsible for heredity.
7 0
3 years ago
Read 2 more answers
Other questions:
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What are the three types of symbiosis?
    12·1 answer
  • The structure of DNA resembles a spiral<br>staircase, also known as a double​
    5·1 answer
  • HURRY QUICK I NEED AN ANSWER
    10·1 answer
  • What are the nitrates is used to make?
    9·1 answer
  • What type of plate boundary form trenches
    14·1 answer
  • HELP due today in 5 min DONT G O O G L E USE or I’ll get an F
    7·1 answer
  • What is the answers for Q1 and Q2 here?
    15·2 answers
  • Which of the following is a method used to prevent soil depletion? (2 points)
    13·1 answer
  • What did gregor mendel use to discover the principles that rule heredity?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!