Does temperature appear to have been relevant to the amount of oxygen consumed?

Biology

1 answer:

OverLord2011 [107]3 years ago

6 0

Answer:

At a thermoneutral ambient temperature, cooling either thermode increased oxygen consumption. In a cold environment, cooling either thermode increased the rate of oxygen consumption more than at a thermoneutral temperature. Heating either thermode tended to decrease oxygen consumption in a cold environment. 3.

Explanation:

You might be interested in

Suppose a species lived in an environment that changed very little over millions of years. Which theory about how fast evolution

hjlf

Gradualism is referred to the theory about how fast evolution occurs in this type of species.

<h3>What is Gradualism?</h3>

This type of evolutionary changes occurs gradually and not in large steps or volume.

This however explains why the species had very little changes for a very long time as a result of the environment being best suited for them.

Read more about Gradualism here brainly.com/question/20463574

#SPJ1

4 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

What do all living things not need ( a place to live, <br> parents, water, energy

MrMuchimi

If you are implying one these choices not needed for survival it would be parents only when you can survive on your own (I'm not that sure but I hope this helped the slightest but)

5 0

3 years ago

When a muscle receives nerve signal (blank) and pulls on a tendons

soldi70 [24.7K]

When a muscle receives nerve signal contracts and pulls on a tendon.

8 0

3 years ago

Read 2 more answers

What is the value of a transitional fossil?

antoniya [11.8K]

Traditional forms shows the evolutionary steps between species

8 0

3 years ago