1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vladimir79 [104]
2 years ago
11

What are the two reactants and two products for the process of photosynthesis?

Biology
1 answer:
aniked [119]2 years ago
8 0
The two reactants are carbon dioxide and water.
The two products are oxygen and glucose.

Hope this helps!
You might be interested in
Which sentence is a complex sentence? A. Antony checked out one book from the library. B. Tim scored two points, and Alex scored
Leona [35]
The answer is c when suzi grows up
5 0
3 years ago
Read 2 more answers
What evidence for the age of the Earth is indicated by the fact that sedimentary rock is found on mountain tops? that the Earth
Ket [755]

The correct answer is - That some force lifted the rocks from the water.

The fact that there's sedimentary rocks on the tops of the mountains is an evidence that there has been some force that managed to lift upwards parts of the seafloor. Taking into consideration how slowly this force manages to lift up parts of the Earth, we can easily assume that the Earth is very old. The amount of time that is needed for a part of the seafloor to be lifted few thousand meters upwards is counted in tens of millions of years, thus giving us evidence that the Earth has been around for a very long time.

8 0
3 years ago
Read 2 more answers
Why do some women use saheli pills?​
wlad13 [49]
These pills inhibit ovulation processes as well as implantation. Therefore, women can prevent unplanned pregnancy by using these pills
7 0
2 years ago
Read 2 more answers
A _____________ mixture is made of different materials that can easily be separated.
Murljashka [212]
A heterogeneous mixture is made of different materials that can easily be separated.
6 0
2 years ago
Read 2 more answers
What do you think would happen if producers did not exist ?
yan [13]
Well for starters, producers are living organisms that produce their own food. Like plants. And plants ironically provide us humans with oxygen as they live off of the carbon dioxide we produce. Some plants are also main vegetables that we eat, so put simply, a world without producers would be practically oxygen-less and vegetable-less.
8 0
2 years ago
Other questions:
  • What is the best explanation for why a bacteriostatic treatment might be chosen over a bacteriocidal treatment?
    13·1 answer
  • What function makes the HIV virus unique?
    11·1 answer
  • Many people try to eliminate fat from their diet
    13·1 answer
  • Question 13
    14·2 answers
  • Renewable energy is generally better for the environment as it produces less pollution.
    15·2 answers
  • Please Answer!!!?!
    14·1 answer
  • What happens during primary wastewater treatment? Choose one: A. Insoluble particles are removed by settling. B. Microbes are ad
    15·1 answer
  • How do I know if a girl is mad at me? (over text)
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Is sample M most likely to be chicken, rice, a mango, or butter?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!