1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marat540 [252]
4 years ago
11

What makes a mutation cancerous?

Biology
2 answers:
Vladimir [108]4 years ago
8 0
Because cancer is caused by changes, (mutations) to the DNA within cells, (The DNA inside a cell is packaged into a large number of individual genes each of which contains a set of instructions telling the cell what functions to perform (and how to grow and divide)) the changes we have or are occurring is often not in recollection to what changes are actually being made to our body, therefore, making it more of a possibility to cancer. (Cancerous)  
Hope this helps! :) 
Len [333]4 years ago
4 0
Cancer is caused by changes in DNA
You might be interested in
Liquid water will change state from _____ to _____ at 0 °C when heat energy has been removed.
Basile [38]

Liqiud water will change from a liquid to a solid at 0°C when heat energy has been removed.

Think about it liquid water expands when it turns into ice.

3 0
4 years ago
Read 2 more answers
How does the carbon locked in shells of marine organisms move back to the atmosphere
nikitadnepr [17]

Answer:

through the process of respiration

Explanation:

4 0
3 years ago
What is the structure of amino acids?
zheka24 [161]

Answer:

Ch plus = O

Explanation:

5 0
3 years ago
If a parent cell has 20 chromosomes, how many chromosomes will each daughter cell have at the end of the cell cycle
shtirl [24]

Answer: After mitosis, the daughter cell has 20 chromosomes and after meiosis, the daughter cell has 10 chromosomes.

Explanation:

8 0
2 years ago
Que es una escala musicál?
yulyashka [42]
Hola!

<span>En la teoría de la música, una escala es cualquier conjunto de notas musicales ordenadas por frecuencia o tono fundamental. Una escala ordenada al aumentar el tono es una escala ascendente, y una escala ordenada por un tono decreciente es una escala descendente.


</span><span>¡Espero que esto ayude!
</span>
~Lauv

8 0
3 years ago
Read 2 more answers
Other questions:
  • Cichlids are bony fish that are commonly found in the freshwater lakes of Africa, like Lake Victoria. There are more than 2000 r
    5·2 answers
  • Compare the equations for respiration and photosynthesis, how are they similar and how are the two different?
    12·1 answer
  • Chipko Movement was started bybishnoi samaj of Rajasthan​
    5·2 answers
  • What happens if you place human red blood cells in a concentrated salt solution
    12·2 answers
  • How can i explain the answer
    12·1 answer
  • Causes and Solutions for Water pollution(Grade-7) ​
    9·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • What releases oxygen into the atmosphere?
    11·1 answer
  • How do you tell wether a substance is a rock or a mineral
    9·2 answers
  • Which type of population growth is shown on this graph?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!