1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
finlep [7]
3 years ago
6

Mycorrhizae enhance plant nutrition mainly by ________.

Biology
1 answer:
liq [111]3 years ago
8 0

The answer is C. A mycorrhiza is a symbiotic association between a fungus and the roots of a vascular host plant. They colonize the roots of vascular plants connect them, one to the other; and then send out their filaments, called hyphae, as much as 200 times farther into the soil than the roots they colonize.






You might be interested in
Genetic modification of organisms in aquafarming
densk [106]
The answer would be B
6 0
3 years ago
If a pure-bred tall plant is crossed with a pure-bred short plant, the offspring will be:
Dmitry [639]
I would say A. Either tall or short
When Mendel crossed purebred short plants with purebred tall plants, all of the offspring were TALL

The pure-bred tall plant dominated the short
7 0
3 years ago
The bases found in the nucleotides of a DNA molecule are<br>&amp;<br>there are chromosomes are​
Tomtit [17]

Answer:

The DNA molecule is a polymer of nucleotides. Each nucleotide is composed of a nitrogenous base, a five-carbon sugar (deoxyribose), and a phosphate group. There are four nitrogenous bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). A DNA molecule is composed of two strands.

4 0
3 years ago
The graph shows the changes in the number of animal fauna's living on earth overtime in how the fauna's were affected by differe
eduard

Answer: C) The event at the end of the Triassic Resulted in the extinction of fewer fauna’s then in any other period

Explanation:

Looking at the graph, the event at the end of the Triassic resulted in the smallest dip in the amount of fauna in the graph. This means that this event resulted in the extinction of fewer faunas than any of the other five major events.

Option A is wrong as the event at the end of the Devonian decreased the number of Cambrian fauna.

Option B is wrong as the event at the end of the Cretaceous resulted in a decrease in the Paleozoic fauna.

Option D is wrong because the event that resulted in the Extinction of more fauna’s then in any other period was the event at the end of the Permian.

4 0
3 years ago
In scientific inquiry, when competing hypotheses have been eliminated, a hypothesis may be elevated to the status of a scientifi
svetlana [45]

Answer:

Scientific Theory

Explanation:

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is not a characteristic of water-soluble vitamins?​?
    6·1 answer
  • Consider the stage of cellular respiration that is shown in the diagram.
    5·2 answers
  • Select all that apply.
    14·1 answer
  • If the concentration of atp in an
    14·1 answer
  • Which of the following is not a source of genetic variation?
    5·2 answers
  • HELP ASAP! 5 questions
    6·1 answer
  • Which part of photosynthesis uses carbon dioxide?
    6·2 answers
  • 13. What difference(s) occur between mitosis and meiosis?
    14·1 answer
  • Which part of the cell theory refers to the flow of energy through a cell?to the flow of information through a cell?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!