1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kicyunya [14]
3 years ago
8

A 16-year-old adolescent informs her nurse that she became a vegetarian 1 year ago. lately she is reporting fatigue and has trou

ble concentrating. a quick blood test ordered by her licensed provider informs the nurse that she has pernicious anemia. this is a deficiency of what vitamin?
Biology
1 answer:
Lapatulllka [165]3 years ago
6 0

Base on the given symptom and observance from the sixteen year old, she has a deficiency of the vitamin b12 in which she could acquire from meat products. She has a deficiency of this vitamin because she has not been taking up meat products as she became a vegetarian.

You might be interested in
2.3.4 Quiz: DNA Technology
Paladinen [302]

Answer:

I think its the choice a

Explanation:

3 0
3 years ago
Points give a answer
stiks02 [169]

Answer:idk

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following is NOT associated with a
NikAS [45]

The two diagrams below represent a sugar molecule and a fat molecule 1 point that is used by living organisms. Which statement best describes these two molecules?

3 0
3 years ago
Mary, age 37, is pregnant for the first time, and her doctor has ordered a series of routine screening procedures. mary’s doctor
Elan Coil [88]
Probably Mary's doctor will not doctor a chronic villus sampling because of her first time pregnancy at the aged of 37 and her doctor ordered so many series of routine screening procedure. The doctor will not order a chronic villus sampling on Mary.
6 0
3 years ago
A(n) _____________ is a pattern of dark bands on photographic film that is made when DNA fragments are separated by gel electrop
Ainat [17]
DNA fingerprint is a pattern of dark bands on photographic film that is made when DNA fragments are separated by gel electrophoresis and tagged. The photograph produced is often used to determine whether or not suspects were involved in a crime.

hope this helps!
3 0
3 years ago
Read 2 more answers
Other questions:
  • how much is celebration is produced in one kilogram body a force of 20 Newton makes angle 30 degree with horizontal (u=0.4)​
    11·1 answer
  • Ancient rift valleys and deep caves often contain human fossils that can provide clues about human evolution and the lives of ou
    15·1 answer
  • Once meiosis occurs gametes are formed with a reduced number of chromosomes. The gametes are
    10·1 answer
  • Why dont earth quakes count as severe weather
    8·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is the basis on which the subdivisions in a Geological time scale are made
    6·1 answer
  • Which region of the operon does the repressor bind to?
    14·1 answer
  • The moon’s origin can be explained by a theory called the impact theory.
    5·2 answers
  • Studying embryology help scientists understand
    13·2 answers
  • Which of the following is the best way to slow the greenhouse effect? drive more often stop using electricity use energy sources
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!