1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ss7ja [257]
3 years ago
6

An increased greenhouse effect and the depletion of the ozone layer are two examples of

Biology
2 answers:
Ipatiy [6.2K]3 years ago
4 0

I believe that they are two examples of human activities.

Karo-lina-s [1.5K]3 years ago
3 0

Human activities........

You might be interested in
Katie helped Sandra with her homework. In return, Sandra helped Katie learn how to rollerblade. Katie didn't expect to get some
adelina 88 [10]

you see katie helped sandra with homework, which helped sandra not fail. Because katie did not let sandra fail, sandra can graudate and get a job. She can also thank katie for not letting sandra fail and go homeless.


sandra helped katie rollerblade. which has no significant impact. Who cares about rollerblading.

your answer is C


5 0
3 years ago
Which of these best describes extinction events?
SpyIntel [72]

Answer: D. Extinctions occur at higher rates during times of ecological stress when populations and species are poorly adapted.

7 0
3 years ago
Read 2 more answers
During infection, C. diphtheriae expresses a variety of genes that are used to establish infection and cause disease. One of the
galina1969 [7]

Answer:

B. AUU CGC AUC UUG AAC

Explanation:

<em>According to the rule of base pairing in DNA, the pyrimidine bases always pair with purine bases. Specifically, adenine (A) always pair with thymine (T) while Guanine (G) always pair with cytosine (C). In RNA, thymine is replaced by uracil (U).</em>

Hence, TAA GCG TAG AAC TTG  will give

             AUU CGC AUC UUG AAC.

The correct option is B.

3 0
3 years ago
The advantages of seeds, compared to spores, include ________.
d1i1m1o1n [39]
Seeds have cotyledons from where they can draw their nutrient in their early stages of development. Pollens must draw their nutrient from their environment from the start. Seeds have an outer coating (testa) that protects the embryo and enable it to remain dormant in the soil until right conditions for growth set forth Seeds have a fully developed embryo that can begin to grow immediately there are right conditions. However, pollen has a single cell instead of an embryo, which must undertake cell division and specialization before beginning to germinate
4 0
3 years ago
Will copper, lead, liquid water, or basalt cool down the fastest?
Sphinxa [80]

Answer:

copper

Explanation:

3 0
3 years ago
Other questions:
  • Im looking for cool and interesting facts about the Lycoris flower/Red Spider Lily for a report if anyone can help, the answer w
    5·1 answer
  • The subunits (building blocks) of proteins are
    7·1 answer
  • Where in the cell is the tag incorporated into the protein?
    15·1 answer
  • Can energy be transferred from animal to animal
    15·2 answers
  • Your lab group is presented with an unknown mollusk. Your task is to assign it to one of the major taxonomic classes. Which char
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which of the following is an example of a population?
    13·2 answers
  • Transcribe the following DNA Strand:<br> AAT GGC TCA
    15·1 answer
  • Which phase occurs directly after S phase?<br> • A. G2<br> B. G1<br> C. Cytokinesis<br> D. M phase
    10·1 answer
  • Choose the answer that places the following events of protein synthesis in the proper order.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!