1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marshall27 [118]
4 years ago
8

Which scientist most likely studied tadpole cells under a microscope?

Biology
2 answers:
iVinArrow [24]4 years ago
6 0

Answer:

Robert Hooke

Explanation:

Hooke would be most likely

4vir4ik [10]4 years ago
5 0
Lee Hooke was the scientist that was most likely to study the tadpole cells uner a microscope. So C. is your answer hope this helped!

~Shadow
You might be interested in
Separation caused by geographic division is called ? A) allopatric speciation B) genetic speciation c) parapatric speciation D)
just olya [345]
The correct answer would be A
4 0
4 years ago
2). What do plants do with the sugars they produce in photosynthesis. Describe at least two different processes and two differen
SCORPION-xisa [38]
The sugar that is produced in photosynthesis is a glucose.
- Glucose can be used to provide energy for cellular activity.
- Excess of glucose is transformed into starch. Starch is transported into storage organs.
- Glucose can be transformed into cellulose, pectin, and chitin. These molecules are structural materials for the cell walls.
- Fats and amino acids can be formed from glucose. These molecules can serve as structural materials or can be stored.
8 0
3 years ago
If a dam is removed, the river and estuary ecosystem will recover<br> A True<br> B False
Novay_Z [31]

Answer:

true

Explanation:

4 0
3 years ago
Read 2 more answers
The substance that are present before any chemical reaction are called
wariber [46]
Reactants. Reactants are the substances that are needed for a chemical reaction to occur. Without reactants there are no products.
8 0
3 years ago
Read 2 more answers
HELP NEED ANSWER QUICK!!!!
lukranit [14]
B. Scarcity of drinking water

3 0
3 years ago
Read 2 more answers
Other questions:
  • Predict: logging removes vegetation that anchors soil and prevents erosion. how do you think logging will affect a coral reef? e
    10·1 answer
  • Which of the following is (are) an accurate description of an implication of sexual reproduction (as in large animals like human
    14·1 answer
  • Moving tectonic plates can form<br><br> mountains<br><br> deltas<br><br> rivers<br><br> sand dunes
    14·2 answers
  • M.G., a "frequent flier," is admitted to the emergency department (ED) with a diagnosis of heart failure (HF). She was discharge
    7·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What would happen if a planet weren’t in the Habitable Zone?
    13·2 answers
  • What does anerobic mean
    9·1 answer
  • List all structures of an animal cell
    5·1 answer
  • Which of the following is one of the products of cellular respiration?
    15·2 answers
  • The genetic material inherited in an organelle, such as a mitochondrion or a chloroplast, exhibits _____ inheritance.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!