1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hunter-Best [27]
3 years ago
7

Do chicken contain lipids?

Biology
2 answers:
ololo11 [35]3 years ago
5 0

Answer:yes they do

Explanation:Lipids and fatty acids in roasted chickens. ... Regarding to the lipids content, the skinless breast showed the lowest content, 0.78 g/100 g, while the back with skin was the one with the highest content, 12.13 g/100 g except for the pure skin, with 26.54 grams of lipids by 100 grams.

Anvisha [2.4K]3 years ago
3 0

Answer:

lipids is fat, yea chicken contain lipids

You might be interested in
While researchers have discovered that there are an excessive number of receptor sites for _________________
Yuki888 [10]

Answer:

While researchers have discovered that there are an excessive number of receptor sites for dopamine, it is not the only neurotransmitter involved in schizophrenia.

Explanation:

7 0
3 years ago
What determines the type of igneous rock that forms from magma? a. The heat and pressure the magma is exposed to b. Whether the
OLEGan [10]

Answer:

c. Magma composition and cooling rate.

Explanation:

A rock cycle can be defined as a concept used to describe the continuous process that leads to a rock's creation, formation, transformation from one form to another, destruction and reformation over a specific period of time. The natural phenomenons that influences the rock cycle are weathering, plate tectonic activity, erosion, etc.

Basically, the three (3) main types of rocks are; metamorphic rock, sedimentary rock and igneous rock.

All igneous rocks are produced from magma (lava) and formed at the Earth’s surface, thereby, causing them to have a coarse texture and dark colors.

Generally, the cooling and solidification of magma (lava) leads to the formation of an igneous rock, either when the melted rock is still inside the continental crust of the Earth or at volcanoes on the Earth's surface.

Hence, magma composition and cooling rate determines the type of igneous rock that forms from magma. Some examples of an igneous rock are granite, obsidian, tuff, basalt, rhyolite, andesite, pegmatite, dacite, scoria, pumice, etc.

4 0
3 years ago
Identify the best description of a heme group.
Fed [463]
I would say d. Multi-part protein that reversibly binds to oxygen molecules (...)
8 0
3 years ago
I need help plzzzzzzzz
AVprozaik [17]
The answer is c) plantae
5 0
3 years ago
Physics <br><br>Solve this <br>And also tell what is 1dm3​
Veseljchak [2.6K]

Explanation:

1 dm3 is a cube with dimension 1 deci meter

6 0
3 years ago
Other questions:
  • Describe the unique appearance of diatoms. what chemical compound composes their outer covering, and what is this shell called?
    12·1 answer
  • Sweat, mucus, tears, and saliva all contain ____________ that kill pathogens.
    8·1 answer
  • What molecules make-up the sides of a dna molecule
    5·1 answer
  • Is the active site located on the enzymes or the substrate?
    13·1 answer
  • Fill in the gap. ___________ is towards the animal's head.
    12·1 answer
  • In a cyclic population _____.
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The diploid number of chromosomes in the mustard plant, Arabidopsis thaliana, is 10. Knowing this, answer the following question
    10·1 answer
  • Look at this picture and help me out plz
    11·2 answers
  • I’ll really appreciate it if you help me out with these 2 questions .
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!