1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexandra [31]
3 years ago
7

What is the purpose of mimicry

Biology
1 answer:
Dahasolnce [82]3 years ago
7 0
The purpose of mimicry is to protect the organism from predators.
You might be interested in
In fruit flies, a specific gene mutation causes the wings to become malformed. These wings are called vestigial because they do
tamaranim1 [39]

You get VV, Vv, Vv, and vv

3 0
3 years ago
Which procedure involves the destruction of a blood clot using anticlotting agents called clot-busters
arsen [322]

Answer:

Lytic therapy - A clot-busting medication given in the hospital into the blood vessel to break up clots. The treatment has a risk of bleeding.

3 0
2 years ago
Plz help with this problem.
Nataly [62]

Answer:

about 29% ( I'm not sure tho I'm sorry)

5 0
3 years ago
Which option describes a condition required for natural selection to occur?
Vika [28.1K]

Answer:

You need to know the conditions required for natural selection to occur. These include: overproduction of offspring, inherited variation, and the struggle to survive, which result in differential reproductive success. You need to understand genetic drift and gene flow

Explanation:

6 0
3 years ago
What are some of the functions of vascular tissue in seedless plants? (Choose all that apply)
olga2289 [7]

Answer:

Explanation:

Xylem transports and stores water and water-soluble nutrients in vascular plants.

Phloem is responsible for transporting sugars, proteins, and other organic molecules in plants.

Vascular plants are able to grow higher than other plants due to the rigidity of xylem cells, which support the plant.

7 0
3 years ago
Other questions:
  • ~I will make you Brainliest!~
    6·1 answer
  • Which statement best describes the relationship of photosynthesis and energy
    15·1 answer
  • Which report helps identify which browsers may have had problems with your website?
    9·1 answer
  • The surface of the conchae are lined with ciliated respiratory epithelium is called
    5·1 answer
  • If, after extensive research, the expected observations predicted by a theory fail to materialize, then the theory _____
    7·2 answers
  • if you are looking through an eyepiece with 10x× magnification and the objective lens you're using is 40× magnification what is
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Show me a picture of telophase stage of mitosis
    11·1 answer
  • Does mass or velocity have a greater effect on kinetic energy? Why?
    15·1 answer
  • 1. DNA 2. Helicase 3. DNA Polymerase 4. DNA Replication 5. Pyrimidine a. Double stranded molecule that has a deoxyribose sugar.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!