1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
8

1. Explain the five steps of the scientific method.

Biology
1 answer:
RideAnS [48]3 years ago
5 0
1. Scientific method is the techniques that scientists used to carry out investigation process. It is made up of five steps, which are:
a. Observation: this is the stage in which a scientist make an observation to which he did not have an explanation.
b. Formation of a research question:  in accordance to observation made, the scientist form a question on which his experiment will be based
c. Formation of hypothesis: at this stage the scientist offers a proposed explanation for the observation which he had made and state what he expects at the end of the experiment.
d. Conduction of the experiment: at this stage the scientist carry out the experiment using appropriate means.
e. Analysis of data and drawing of conclusion: this is last stage of the investigation, at this stage, the scientist analysis the results he obtained and draw a conclusion based on the results of the data.

2. Scientists used scientific method to carry out scientific investigations because the method minimize the influence of bias and prejudice in the experiments that they carry out. The method provides an objective, standardized approach to scientific investigation; this result in reproducible results which can be achieved by other scientists in every parts of the world. The method also helps to minimize errors during investigation.
You might be interested in
What do scientists use to mark boundaries in the geologic time scale?
tekilochka [14]

Era is used to mark the boundaries of geological time scale by using radio carbon dating technique.

Explanation:

Geological time starts with Precambrian time.

Geologically, time is divided between the Precambrian era and present time into era.

The three eras are Paleozoic era, Triassic period and Cenozoic era.

Era is further divided into periods.

Scientists use radio carbon dating to study fossils and rock formation. With this study they were able to divide them in exact geological scale.

Geologic scale is the record of events in earth's history and evolution.

3 0
3 years ago
What kinds of muscle is located only in the heart?
FromTheMoon [43]
I believe it is called the cardiac muscle.
7 0
3 years ago
Read 2 more answers
What is it true that Barack Obama wants the people listening to his speech to have
Lesechka [4]

Please finish the sentence.

5 0
3 years ago
Can some help me with this question bc no one answered it before for me​
tensa zangetsu [6.8K]
The first answer choice
8 0
3 years ago
Match the labels with the symbols on the weather map.
Tpy6a [65]
Can u link the map and symbols
7 0
3 years ago
Other questions:
  • Which property of water allows blood to aid in the transportation of nutrients and gases throughout the body?
    12·1 answer
  • Process in which chemical energy, instead of sunlight is used to make food
    15·1 answer
  • What is a sentence using Active Transport?
    11·2 answers
  • Reagan is a young girl with a genetic developmental disorder. Her language development has been severely affected by this condit
    10·1 answer
  • What is the next step in the scientific method, following stating a question?
    9·1 answer
  • Describe the structure of atoms,including the masses, electrical charges, and locations of protons, neutrons and electrons.
    10·1 answer
  • 14 How does water form during cellular respiration?
    14·2 answers
  • Which provides long-term energy storage?
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The _____ is the primary channel for the transportation of water, mineral and food from the roots and leaves to the rest of the
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!