1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nina [5.8K]
3 years ago
7

Graphs of what functions are shown below?

Mathematics
1 answer:
shtirl [24]3 years ago
6 0

Answer:

-3/5

Step-by-step explanation:

You might be interested in
88,999 Round to the nearest ten thousand
Bess [88]
It would be 90999 I am really sure :D
5 0
3 years ago
Read 2 more answers
The distance D that a spring is stretched by a hanging object varies directly as the weight W of the object. if a 9-kg object st
sergiy2304 [10]

Answer:

I think it is b

Step-by-step explanation:

7 0
3 years ago
2x1x2x2 order of operations
VMariaS [17]

8? I mean its kind of a guess

4 0
3 years ago
Read 2 more answers
Help me pls? with math!!!
rewona [7]

Answer:

pick number 3

Step-by-step explanation:

5 0
3 years ago
Read 2 more answers
Adam says that the expression 52-3y is equal to 20 when y equal 2.Explain why Adam's answer is incorrect.
larisa [96]

Because when you do 3 x 2=6 and then 52-6 it doesn’t equal 20. It equals 46.

6 0
3 years ago
Other questions:
  • Suppose a triangle has two sides of length 3 and 4 and that the angle between these two sides is 60 degrees . What is the length
    12·1 answer
  • Identify the independent and dependent variables.
    10·1 answer
  • Order of operations<br> 10 _ 2 _ 4 _ 6 _ 3 = 20
    9·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Median of 28, 30, 34, 35
    13·1 answer
  • Suppose a certain computer virus can enter a system through an email or through a webpage. There is a 40% chance of receiving th
    14·1 answer
  • Distribute<br>-3/7 (21x - 7)<br><br>​
    10·1 answer
  • A restaurant offers 4 kinds of burgers, and 4 drinks. How many different combinations of burger and drink can you purchase?
    15·1 answer
  • A sample of 18 small bags of the same brand of candies was selected. Assume that the population distribution of bag weights is n
    9·1 answer
  • How many sides would there be in a convex polygon if the sum of all but one of its interior angles is $1070^{\circ}$
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!