1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fenix001 [56]
3 years ago
11

What type of severe weather would most likely decrease coral reef biodiversity by damaging coral skeletons and polyps?

Biology
2 answers:
Anastasy [175]3 years ago
8 0
The answer i would choose is c typhoon

Nat2105 [25]3 years ago
4 0
B.) Hailstorm is most damaging.....
You might be interested in
What describes how a large host cell and ingested bacteria could easily become dependent On one another for survival resulting i
murzikaleks [220]

Answer:

The endosymbiotic theory describes how a large host cell and ingested bacteria could easily become dependent  on one another for survival

Explanation:

8 0
3 years ago
A woman takes a man to court claiming that he is the father of her son and that the man should be required to pay child support.
Anastasy [175]

Answer: No

Explanation: Since when a child is born it has DNA from both. As an example, the mom has brown hair, father has blonde hair, the child would take the DNA for the type of hair they get, either blonde or brown. So since its blood, the fathers is A, and the boy's is B, therefore it didn't take any of their DNA's so nope, he isn't the father.

6 0
3 years ago
PLEASE HELP (40 POINTS) What role might the processes of protein synthesis play in using CRISPR to modify a defective gene in an
zzz [600]

Answer:

That looks hard, search on google.

Explanation:

8 0
3 years ago
Place the following events in sequence: A) Food enters your large intestine; B) Food enters your small intestine; C) Food enters
Anarel [89]

Answer:

The correct sequence is

1st step- Option C

2nd step- Option B

3rd step- Option A

Explanation:

Initially, when a person swallows the food, it goes into the stomach through a muscular type of tube which helps in the transportation of food items and liquids from the mouth into the stomach, which is commonly known as the esophagus.

After passing through this tube and reaching the stomach, the liquid and food items mix up with the juice that it produces, and eventually releases its particles into the small intestine. These transported particles are known as chyme.

As the food particles reach the small intestine, its muscles allow the food particles to mix up with the digestive juices that are released from the organs namely liver, pancreas, as well as the intestine and helps in the proper digestion of the food. The walls of the small intestine extracts the nutrients that are digested into the bloodstream, where the blood supplies the nutrients into the remaining parts of the body.

After the food is digested and nutrients are absorbed into the body, the remaining waste products or undigested particles are transported to the large intestine, where it extracts the water and converts the waste particles into the stool, which are later eliminated from the body.

Thus, the correct sequence is arranged above.

4 0
3 years ago
PLS HELP!! I need help pls don't troll and first person to answer get brainlist
Anestetic [448]

Answer:

starch

Explanation:

please thank my answer and mark me brainliest

4 0
3 years ago
Other questions:
  • The process in which sperm and egg cells join is called ____________________.
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Would you expect a cactus to have more or less stomata than a tropical plant? why?
    7·1 answer
  • Unlike roots, stems
    14·2 answers
  • 14. En la mayoría de las sustancias, un aumento de temperatura hace que<br> ?<br> (2 Points)
    13·1 answer
  • If you were studying the causes of cancer, which topic might interest you?
    9·2 answers
  • At which position is the southern hemisphere experiencing spring?
    9·2 answers
  • Are any change in the sequence of bases in DNA or RNA that can cause by mutagen or can happen spontaneously in the cell
    14·1 answer
  • HELPP! ILL MARK Y PU BRAINLY!
    11·2 answers
  • This particle has a negative charge.<br><br> 1) proton<br> 2) neutron<br> 3) electron
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!