1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vampirchik [111]
3 years ago
11

100 POINTS! A hypothetical population of 10,000 humans has 6840 individuals with the blood type AA, 2860 individuals with blood

type AB, and 300 individuals with a blood type BB.
What is the frequency of each genotype in this population?

What does the frequency of the A allele?
What is the frequency of the B allele?
If the next generation contain 25,000 individuals, how many individuals would have blood type BB, assuming the population is in Hardy-Weinberg equilibrium?
Biology
2 answers:
nikdorinn [45]3 years ago
5 0
Here's what we know:
10,000 individuals
6,840 individuals have blood type AA
2,860 individuals have blood type AB
300 individuals have blood type BB

AA genotype frequency: 68.4%
AB genotype frequency: 28.6%
BB genotype frequency: 3%

The A allele occurs 6,840 * 2 + 2,860 * 1 = <span>16,540 times, which is a frequency of 82.7%, meaning the B allele occurs 3,460 times, which is a frequency of 17.3%. In the next generation, 3%, or 750, individuals would have blood type BB.</span>
olga55 [171]3 years ago
4 0
The Hardy - Weinberg equations are meant to connect a statistical model to primarily Biological characteristics. This is a classic example of how these equations should be used.

This equilibrium has 5 conditions that must be obeyed. Two of the most important are that your sample must be a closed sample which means that no new members are let into the tested group, and none of the group can leave. The second condition is that in order to declare equilibrium the second sample taken must confirm the first. So this is very theoretical.

Equations
A + b = 1
A^2 + 2Ab + b^2 = 1

Method
The examples given always start with the recessive characteristics. In this case, there were 300 out of 10000 that were bb. So you have to figure out that if bb = 300/10000 what does b equal.

b^2 = 300/10000 = 0.03
b = sqrt(0.03)
b = 0.1732 

From this result, using A + b = 1 you get that
A = 1 - b
A = 1 - 0.1732 
A = 0.8268

Finding AA and Ab
A = 0.8268
A*A = 0.8268^2 
AA = 0.6836

Ab = 0.8268 * 0.1732
Ab = 0.1432
2Ab = 2*0.1432
2Ab = 0.2864

Confirming Hardy Weinberg
If the sample has 10000 members total, then 
AA = 0.6836 * 10000 = 6836 members.
2Ab = 0.2868 * 10000 = 2868
bb = 0.03 * 10000 = 300
The total is 10000 as expected.

Do these results follow the second Hardy Weinberg Equation
AA + 2Ab + bb = 0.6836 + 0.2868 + 0.03
AA + 2Ab + bb = 1.0004 which can be explained as a rounding error. 
 
If the sample next year is 25000, what should the results be?
The sample states that in the second year, the sample size is 25000. Equilibrium will be established if the 25000 is calculated with the same ratios.

AA = 0.6836 * 25000 = 17090
2Ab = 0.2868 * 25000 = 7170
bb = 0.03 * 25000 = 750

Confirmation
17090 + 7170 + 750 = 25010 which again can be a rounding error.
Note: you can get a confirmation by just multiplying the numbers you got for 10000 by 2.5
For example bb = 2.5 * 300 = 750
For 2Ab = 2868 * 2.5 = 7170
I'll leave AA to you
You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
Choose the statements below that are true.
Paladinen [302]
What statements??? There is nothing there
4 0
3 years ago
The two main phases of the cell cycle are the cytokinetic phase and interphase
Vitek1552 [10]

Answer:

Flase

Explanation:

The cell cycle has two major phases: interphase and the mitotic phase. During interphase, the cell grows and DNA is replicated. Usually the cell will divide after mitosis in a process called cytokinetic in which the cytoplasm is divided and two daughter cells are formed.

hope this helps

have a great day/night :)

4 0
3 years ago
Read 2 more answers
DNA is one example of how genetics is used as evidence of evolution. Explain what this is and how it is used
Inessa [10]
Breaking cells open to release the DNA.
Separating DNA from proteins and other cellular debris.
Precipitating the DNA with an alcohol.
Cleaning the DNA.
Confirming the presence and quality of the DNA.
3 0
3 years ago
In semiconservative dna replication, each new double helix formed will have
Gnesinka [82]
In semiconservative DNA replication, each new double helix that will form will have 1 polynucleotide strand that is from the old DNA molecule and is an Old or Parent strand, and will have a polynucleotide strand from the newly synthesized one, the new DNA strand.
7 0
3 years ago
Other questions:
  • Jupiter, Saturn, Uranus, and Neptune are a known as ________. a. terrestrial planets c. dwarfs b. ringed giants d. gas giants Pl
    5·2 answers
  • The picture shows an interaction within an environment which describes the interaction
    10·2 answers
  • Which metabolic defects are associated with stone formation? hyperparathyroidism hypouricemia hyperthyroidism hypoparathyroidism
    7·1 answer
  • What type of learning shapes innate behaviors? 
    13·2 answers
  • Your science teacher has asked the class to make a cell city model. Which building or business in the city could represent the m
    11·1 answer
  • How long does copper deposits takes to form
    7·1 answer
  • Help please biology 1
    12·1 answer
  • Which gas is released during the light reactions of photosynthesis?
    8·1 answer
  • BRAINLIST PLEASE HELP ME
    9·1 answer
  • If a cell were placed in a dark environment, which organelles would
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!