1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
juin [17]
3 years ago
10

Who's good at science

Biology
1 answer:
dimulka [17.4K]3 years ago
8 0
I am. I have a 100 average in the class.
You might be interested in
How does the water cycle purify water
dimulka [17.4K]

During the water cycle some of the water in the oceans and freshwater bodies, such as lakes and rivers, is warmed by the sun and evaporates. During the process of evaporation, impurities in the water are left behind. As a result, the water that goes into the atmosphere is cleaner than it was on Earth.

6 0
2 years ago
Reasons why organ donation after death should be encouraged
Wewaii [24]
One good reason would be that they could give someone, or many people who are in desperate need of a new organ, a second chance at life.
4 0
3 years ago
What’s the difference between a theory and a law?
Kitty [74]

A theory is a hypothesis that someone had but has not proven it.

A law is something that is proved.

Example: Sir Issac Newton had a theory on gravity he sat under a tree and then had a conclusion.

4 0
3 years ago
Read 2 more answers
Primates are considered to be the most advanced group of mammals. Which of the following characteristics is NOT common to all pr
Ilya [14]
The answer is B.- Upright bipedal walking posture.
8 0
3 years ago
Give an example for each of the following.
kati45 [8]

Answer:

Vascular plants have two distinct organ systems: a shoot system and a root system. baked goods.online proccesing.  frame, and cars

Explanation:

7 0
3 years ago
Other questions:
  • Which of lead protein stricture to the x helix and the b pleated sheet represent?
    8·1 answer
  • At which trophic level do decomposers work
    8·1 answer
  • When you place a ball at the top of a hill and it accelerates toward the bottom
    5·1 answer
  • 1. The first organisms on Earth were<br> mostly likely
    6·2 answers
  • What are chromosomes
    14·2 answers
  • Carnivora plants obtain ____ from the ____ they eat
    11·2 answers
  • In pea plants there is a dominant allele (A) for green pods and a recessive allele (a) for yellow pods. Suppose a heterozygous p
    10·1 answer
  • What is the difference between a hypothesis and a theory
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which part of the digestive system illuminates solid wastes From the human body
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!