1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Xelga [282]
3 years ago
5

What problems could occur if scientists did not communicate the results of their investigations?

Biology
1 answer:
Lerok [7]3 years ago
4 0
They could make errors which would lead to inaccurate results.
You might be interested in
a dna restriction enzyme cuts dna at a specific sequence. if a restriction enzyme that cuts at the dna sequence gaattc were used
vitfil [10]

Four bands appear in gel electrophoresis. Gel electrophoresis is an experimental method used to separate mixtures of DNA, RNA, or proteins by molecular size.

DNA is negatively charged, so when a current is applied to the gel, the DNA migrates towards the positively charged electrode. Fragments are ordered by size because short DNA strands migrate through the gel faster than long strands. There are some basic steps for performing gel electrophoresis outlined below. 1) pour the gel, 2) prepare the sample, 3) load the gel, 4) run the gel (expose it to an electric field), 5) stain the gel. Gel electrophoresis is a technique for separating biomolecules by size. Separation of these molecules is achieved by placing them in a small pore gel and creating an electric field across the gel

To know more about gel electrophoresis visit:

brainly.com/question/9437877?referrer=searchResults

#SPJ4

4 0
2 years ago
HCl is added to a solution containing barium and calcium ions. If a precipitate is formed, what is it? A. No precipitate is form
Luden [163]

Answer:

A. No precipitate is formed.

Explanation:

Hello,

In this case, considering that both calcium chloride and barium chloride are CaCl₂ and BaCl₂ respectively, due to their high polarity by cause of the ionic bond they have between calcium and chlorine and barium and chlorine we say they are highly soluble in water, therefore, A. No precipitate is formed.

Best regards.

5 0
3 years ago
Biology..please help..TYVM
seropon [69]
B nucleic acids or c nucleotides
8 0
3 years ago
Read 2 more answers
I I need help please ??!!
elena-s [515]
All matter has energy ( matter and energy are technically the same thing )
energy matter has when still
5 0
3 years ago
Read 2 more answers
Chrysanthemums are short-day plants. select conditions in which you expect chrysanthemums to flower.
SpyIntel [72]

Due to the information that they are short-day plants, I would expect chrysanthemums to flower during the times of the year when <u>days are shorter and nights are longer. </u>

Plants require sunlight to grow and flower or produce fruit. While some plants require more light than others, almost all plants require some form of light to survive, much less flower. Pants are often classified according to the amount of light that they require, these classifications are:

  1. Day-neutral plants
  2. Long-day plants
  3. Short-day plants

Day-neutral plants are those that can flower regardless of the amount of light that they receive. These are very resistant species of plants that can thrive even through periods of prolonged darkness. Though they do well with even a small amount of light, they will still require it to survive. One example of this kind of plant is the <em>tomato</em>.

Long-day plants are, as the name may suggest, plants who thrive when the days are longer. These plants will not survive or bloom without many hours of sunlight every day. The <u>optimal conditions for this kind of plant are meet during the summer,</u> when the Earth is tilted towards the sun, causing longer days.

Finally, short-day plants are those who require little sunlight to flower. These are different from day-neutral plants in that during days with many hours of sunlight, they will not flower. These plants, such as the chrysanthemums, will only flower if daylight hours are low, meaning that <em>spring</em> and <em>fall</em> are <u>optimal conditions for these plants to prosper. </u>

To learn more:

brainly.com/question/24849266?referrer=searchResults

4 0
3 years ago
Other questions:
  • ack is seeing an onion cell under a microscope. He observes formation of a cell plate. He is observing which phase of the cell c
    5·1 answer
  • using figure 9-1, which pairing matches the structures shown in the cell diagrams with the processes that take place within thos
    7·2 answers
  • A labor. atory method of cutting apart and recombining genes to produce recombinant DNA
    6·1 answer
  • What is the greatest use of groundwater?
    13·2 answers
  • Why is the use of iodised salt advisable?
    13·2 answers
  • Which TWO of these processes remove airborne CO2 from Earth’s atmosphere?
    10·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Cellular Respiration
    5·2 answers
  • Why Is DNA important for protein synthesis?
    13·1 answer
  • Recall that heterozygous individuals show the _______________ phenotype but still have a ________________ allele in their genome
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!