1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
3 years ago
14

Magnetic field lines around a bar magnet

Biology
1 answer:
leonid [27]3 years ago
7 0

b. spread out from one pole and curve around to the other.

You might be interested in
someone has their blood tested and finds that their blood sugar level is 138. this is equivalent to 1.38%. How much glucose is i
disa [49]

The amount of glucose in each ml of their blood will be 0.00138 g.

<h3>Blood glucose concentration</h3>

The concentration of glucose in the person's blood is 1.38%.

This means that there is 1.38 g of sugar per Liter of blood.

1 Liter of blood contains 1.38 g of glucose, and there is 1000 mL in 1 Liter of blood.

1000 mL contains 1.38 g

1 ml contains = 1.38 x 1 / 1000 = 0.00138 g

This means 0.00138 g of glucose will be present in every 1 mL of the person's blood.

More on blood glucose can be found here: brainly.com/question/8394646

#SPJ1

3 0
2 years ago
What does a pyramid of biomass represent ?
MArishka [77]

Answer:

Explanation:

i don't know but that sucks for you

7 0
3 years ago
Read 2 more answers
Why is it important to look at birth and death rates while considering population size
hoa [83]
It is important to look at birth and death rates while considering population size because they determine the population size
4 0
3 years ago
Read 2 more answers
Help please ;-;<br><br> I’ve attached an image of what i need help with. Thanks!
kkurt [141]

Answer:

Explanation:

why do you need the answer

6 0
3 years ago
Read 2 more answers
PLEASE HELP ASAP!!
castortr0y [4]

A is the correct answer!

- water can moderate temperature v. well that's why it's used as a cooling agent

- water expands upon freezing (that's why ice floats on water!)

3 0
3 years ago
Other questions:
  • All cell membranes are primarily composed of _____________.
    14·2 answers
  • Which property of water explains its ability to prevent sudden changes in body temperature?
    9·1 answer
  • What is innate immunity? Discuss the barriers associated with innate immunity.
    14·1 answer
  • Identify the stage of mitosis where the sister chromatids separate and each daughter cell gets one chromosome.
    14·2 answers
  • Give three examples of Ethical scientific behavior?
    15·1 answer
  • All of the following techniques involve hybridization between single-stranded nucleic acid molecules except:
    14·1 answer
  • Which statement best describes this role of plastids in the plant cell?
    6·1 answer
  • _________ molecules don't have charged regions and are hydrophobic.
    7·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • What is the expected functional consequence of movement of a transposable element within the genome?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!