1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Diano4ka-milaya [45]
3 years ago
9

Which of the following statements about resting potential is true? A resting membrane allows much more sodium than potassium to

diffuse across. The concentration of sodium is much higher inside the cell than outside. The resting potential exists because of differences in glucose concentration inside and outside the cell. The sodium-potassium pump contributes to the resting membrane potential.
Biology
1 answer:
AleksAgata [21]3 years ago
4 0

Answer:

The sodium-potassium pump contributes to the resting membrane potential.

Explanation:

This is the stage in which the neuron is not depolarize. 3Na+ are pumped outside  through  the sodium  channels, while  K+ channels are open for2 K+ to enter the cells.After some time the Na+ channels closed up. However some K+ channels still leaks , so that K+ still escape out of the cells to the external environment ,which contains more of Na+. Therefore at this stage there are more Na+ outside the neuron compare to the inside the neuron. Therefore the inside of the neuron is negative , because more K+ are leaving the cells, leaving negatively charged anions inside, and the outside is positive  due to more Na+ are outside, and because the K+ leaking outwards.

The regulation of the Na+ and K+ ions movements is regulated by sodium potassium pumps along the membrane of the neuron. if the potential at this stage is measured, it has a value of -70mv, and it is called membrane potential.

You might be interested in
Sponges are full of holes, jellyfish are big open sacs, and flatworms are flat. How are these features important in facilitating
Katena32 [7]
Answer: 23566 + 789 = l i l
6 0
3 years ago
Cyclostomata are fish _____. made of cartilage without a jaw made of bone
Stels [109]
Lamprey and hagfish are jawless fish, with skeletons composed of cartilage. They do not have scales and are considered primitive fish. They are in the superclass cyclosystoma.
3 0
3 years ago
Read 2 more answers
True or false: mutations are random events that cannot be planned by an organism.
Studentka2010 [4]
False
Mutations can form and be predicted
Depending on the situation
6 0
3 years ago
Before the dna fragments are separated what happens
Hitman42 [59]
How are DNA fragments separated using gel electrophoresis? ... A solution ofDNA molecules is placed in a gel. Because each DNA molecule is negatively charged, it can be pulled through the gel by an electric field. Small DNAmolecules move more quickly through the gel than larger DNAmolecules.Nov 20, 2007
3 0
3 years ago
DNA is a type of ?
Y_Kistochka [10]
B. DNA is short for <span>Deoxyribo nucleic acid, which is nucleic acid..

If this helped please rate, thank, and give brainliest answer!</span>
4 0
3 years ago
Other questions:
  • HELP?! _______ are the simplest creatures that possess an anus. A. Flatworms B. Roundworms C. Jellyfish D. Sea anemones
    15·1 answer
  • A sample of basalt has smaller crystals than a sample of granite. What is the most likely reason for this? The basalt
    12·1 answer
  • Which statements best explains how mitochondria help a cell get the materials it needs?
    15·2 answers
  • Based on your understanding of the hydrologic cycle and oceans, pick the correct statement from the choices below.
    11·1 answer
  • What can happen if a cell makes an error copying its DNA during interphase
    14·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How much oxygen does the amazon rainforest provide
    9·1 answer
  • Anaerobes carry on whereas aerobes carry on cellular respiration
    13·1 answer
  • Biomass is a :
    11·2 answers
  • PLEASE HELP CHOOSE WHAT CLAIM ANSWERS THE QUESTION!!!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!