1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
earnstyle [38]
4 years ago
13

Women are more likely than men to get urinary tract infections because this structure is shorter in women than it is in men. Whe

re is this structure in the image?
Biology
2 answers:
True [87]4 years ago
8 0

Answer:

the answer is number 4.

Explanation:

Mazyrski [523]4 years ago
3 0
I need the image. Make sure to add it in so I can see it!

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Let's suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular
Vaselesa [24]

Answer:

Potential targets:

1- DNA methyltransferases

2- Chromatin modifiers such as histone acetyltransferases, histone deacetylases, histone methyltransferases, etc.

3- Components of the RNA interference (RNAi) machinery such as Dicer, Argonaute, etc.

Explanation:

Epigenetics can be defined as the study of any heritable change in the phenotype that does not involve modifications in the DNA sequence. Epigenetic mechanisms can be classified into three major types: 1-DNA methylation, 2-histone modifications (e.g., acetylation, methylation, phosphorylation, etc), and 3-regulatory non-coding RNAs (e.g., miRNAs, lncRNAs, siRNAs, etc) that modulate target gene expression via the RNA interference pathway. There are different types of proteins that are involved in these complex epigenetic mechanisms, and those cited above represent only some examples that can be used as therapeutic targets.

5 0
3 years ago
When bacteria are inoculated into a new sterile nutrient broth, their numbers don’t begin to increase immediately. Instead, ther
Delicious77 [7]

Answer: First, the bacteria will adjust and then it will divide.

Explanation:

Once the bacterial species is put into the cultural medium, there the bacteria present in the medium needs to acclimatize in the medium and then start growing.

There is a lag phase before the log phase because first the bacteria will adjust into the medium and then start dividing.

As we know that the growing medium contains amino acids, growth factors, enzymes and many more things which first needs to be utilized by the bacteria and then it will start dividing.

5 0
3 years ago
HELP PLEASE!!!! I’ll really appreciate it:( what is the experimental variable, independent variable, dependent variable, control
vlabodo [156]
I’m like 99 Percent sure this is right.

Experimental Variable: Orange Trees
IND. Variable: The Fungi
DEP. Variable: Fruit Weight
Control Group: Group A
Experimental Group: Group B

Hope this helps!
7 0
3 years ago
Compare and contrast dehydration synthesis(condesation) and hydrolysis.
dexar [7]

Answer:

This

Explanation:

In dehydration synthesis reactions, a water molecule is formed as a result of generating a covalent bond between two monomeric components in a larger polymer. In hydrolysis reactions, a water molecule is consumed as a result of breaking the covalent bond holding together two components of a polymer.Aug 14, 2020

3 0
3 years ago
Other questions:
  • What strand of mRNA would be made during transcription using the dna strand shown below
    9·2 answers
  • A black rooster mates with a white hen. Based on their genotypes, the chance that the offspring will be checkered is 100 percent
    8·1 answer
  • What is the final product of translation?
    6·1 answer
  • What type of plate boundary exists today along the Himalayas
    14·1 answer
  • One of Stan's duties is to check the laboratory equipment and machines each morning when he arrives at the office. This morning,
    15·1 answer
  • What is the gastrointestinal system? What does it do?
    9·1 answer
  • What are potential consequences of climate change on biodiversity
    6·2 answers
  • Picture goes with question 1
    14·1 answer
  • The Canada lynx is a rare wildcat in Minnesota. The lynx has large "snowshoe' like feet that enables it to walk on top of deep,
    9·2 answers
  • What is the largest reptile?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!