1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
14

Which statement correctly describes the difference between meiosis 1 and meiosis 2?

Biology
1 answer:
bixtya [17]3 years ago
7 0
Meiosis 1 results in two homologous chromosomes being pulled apart creating two chromosomes that share the same DNA, Meiosis 2 results in two sister chromatids being pulled apart, creating four haploid cells.
You might be interested in
Which of the following is not a physical change? (4 points)
Crazy boy [7]
Burning paper is a chemical change not a physical one. Hope this helped <span>
ノ◕ヮ◕)ノ*:・゚✧</span>

6 0
3 years ago
Read 2 more answers
What's a trait that can possibly mask another trait
Evgen [1.6K]

Answer:

recessive

Explanation:

8 0
3 years ago
Which is most likely a covalent compound?<br><br> A.LiF<br> B.MgS<br> C.NH3<br> D.CaCl2
yKpoI14uk [10]
NH3 since they are both non metals
Answer:C
6 0
3 years ago
Read 2 more answers
What do you think is happening on the molecular level?
RideAnS [48]
A cool looking app gggggg
7 0
3 years ago
Read 2 more answers
What is the importantence of the carbon and nitretan cycles in the environment
Dmitrij [34]
The carbon lives in the plant or animal and when it dies, nitrogen sinks into the soil which is used as nutrients for plants.
7 0
3 years ago
Other questions:
  • Decomposers consume nonliving organic matter. Please select the best answer from the choices provided
    13·2 answers
  • Water that has a very low pH can be collected from hot springs in the area of Glenwood Springs, Colorado. A low pH indicates whi
    11·1 answer
  • All of the following would be useful in trying to obtain procedural information to replicate an experiment previously published
    8·2 answers
  • Sodium (Na) and potassium (K) are in the same group in the periodic table. Sodium is in the 11th position. How many valence elec
    11·2 answers
  • He male reproductive system includes
    14·1 answer
  • Which group of chordates does not possess true backbones?
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following is the most important characteristic that biologists use to classify animals?
    7·1 answer
  • Scientists say that conditions must be "just right" for a hurricane to start up. Which is the first step of "just right" in the
    9·1 answer
  • What do the function and structure of the forelimbs of the 4 animals tell us
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!