What is the priority nursing intervention in the postictal phase of a seizure?

1 answer:

3 0

<span>The answer is: assess the client's breathing pattern.

</span> In the postictal phase, the phase after the seizure, the brain recovers from the trauma caused by the seizure. In this phase the priority is to assess the patient's breathing pattern for effective rate, rhythm, and depth. For this is necessary to apply oxygen and ventilation.

You might be interested in

Explain the activity of protease at pH 4.0 and at pH 7.0

ryzh [129]

Answer: The pH dependence is usually due to the side groups of the amino acids. A change in pH changes the protonation pattern and can, in extreme cases, result in protein denaturation. I therefore suspect that your protein stabilizes the enzyme structure, thus keeping it active at sub optimal pH values.

Explanation: Hope this helps :)

5 0

3 years ago

How has technology changed the way people communicate?

timurjin [86]

Answer: I think it’s C.

Explanation:

4 0

3 years ago

Read 2 more answers

Explain DNA’s structure, specifically noting the role electric fields and forces play in it.

enyata [817]

DNA a double-helix like structure, containing multiple nucleotide sequences consisting of a phosphate group, a sugar group, a nitrogenous base, and a hydrogen bond between two nucleotides. The hydrogen bond is weak so the double-helix can "unzip" and make RNA. I hope this helps!

3 0

3 years ago

Diferencia entre estimulo y receptor

Archy [21]

Explanation:

Un estimulo es cualquier cambio que es capaz de producir una respuesta por parte del organismo. Los receptores son estructuras muy especializadas capaces de percibir los estímulos y convertirlos en impulsos nerviosos

7 0

3 years ago

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Reika [66]

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

3 0

4 years ago