1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lesantik [10]
3 years ago
15

What is the connection between crime and unequal access to basic services?

Biology
1 answer:
Anarel [89]3 years ago
4 0
GovernanceEdit

The regime type of the government is indicator on whether the nation is in danger of genocide or not, an anocratic, or a transitional government, is the government that is in the most danger while a full monarchy, in the most stable. 

Conflict HistoryEdit

A state is more likely to experience genocide or mass atrocity if they have a history of identity-related tensions, otherwise known as a tendency of othering,

Economic ConditionsEdit

States with low levels of economy development are more likely to have problems because it creates low opportunity cost for mass violence, as the citizen’s lives aren't valued as much as in an economy that has high levels. 

Social FragmentationEdit

Social fragmentation can by five major sub categories; identity-based social divisions, demographic pressures, unequal access to basic goods and services, gender inequalities, and political instability.

You might be interested in
In the 1960s the molecular biologist George Streisinger developed the strand- slippage hypothesis. Streisinger noticed that muta
Lesechka [4]
The insertion mutation affect the DNA by changing certain cells
6 0
3 years ago
The energy input into an ecosystem can come from________
AfilCa [17]
I think it would be A and B
4 0
3 years ago
Read 2 more answers
A patient suffering from breast cancer chooses to undergo surgery. Doctors remove the breast where the tumor is. However, doctor
-Dominant- [34]

Answer:

The correct answers are: A single diseased cell can multiply into a new tumor; cancer cells can travel through the blood and spread into new areas; many cancer cells multiply so fast that new tumors can form.

Explanation:

Cancer is the term that groups different conditions that have all one thing in common: there's an abnormal cell growth that can potentially irradiate to other parts of the body.

A single diseased cell can develop a tumor, because this abnormal cell has the capacity to replicate so fast and, of course, transmit its abnormality to every other cell that it generates.

These abnormalities occur because there is some sort of damage in the DNA of a cell, which most of the time is detected by the body and eliminated - but when it's not, the cell quickly multiplies itself and generates a tumor. The difference between a benign tumor and cancer is that cancer can spread through the body and a benign tumor can not.

Cancer is very dangerous and potentially fatal if not treated fast because it can travel through the bloodstream or the lymphatic system and invade other organs, causing metastasis.

There's a lot of research being done on how to cure cancer, but the disparities in every different type of cancer make finding the solution much harder. Nowadays, depending on the type of cancer and the stage where the cancer is, this condition can be treated with radiotherapy, chemotherapy, or surgery.

5 0
3 years ago
What human activities are responsible for soil erosion happening at advansed rates
butalik [34]
Aside from desertification, there is no doubt that human activities are a major cause of soil erosion in general. Construction of roads and buildings, logging, mining, and agricultural production have resulted in large amounts of soil erosion in the U.S. and around the world.

Hope this helps
3 0
3 years ago
Read 2 more answers
name the molecular bond present in carbohydrates that enables change in colour when using Benedict's reagent test​
Helen [10]

Answer:

<em>c</em><em>o</em><em>p</em><em>p</em><em>e</em><em>r</em><em>.</em>

Explanation:

<em>B</em><em>e</em><em>n</em><em>e</em><em>d</em><em>i</em><em>c</em><em>t</em><em>'</em><em>s</em><em> </em><em>s</em><em>o</em><em>l</em><em>u</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>i</em><em>s</em><em> </em><em>s</em><em>i</em><em>m</em><em>p</em><em>l</em><em>e</em><em> </em><em>c</em><em>a</em><em>r</em><em>b</em><em>o</em><em>h</em><em>y</em><em>d</em><em>r</em><em>a</em><em>t</em><em>e</em><em>s</em><em> </em><em>a</em><em>r</em><em>e</em><em> </em><em>h</em><em>e</em><em>a</em><em>t</em><em>e</em><em>d</em><em>,</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>s</em><em>o</em><em>l</em><em>u</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>c</em><em>h</em><em>a</em><em>n</em><em>g</em><em>e</em><em>s</em><em> </em><em>t</em><em>o</em><em> </em><em>o</em><em>r</em><em>a</em><em>n</em><em>g</em><em>e</em><em> </em><em>r</em><em>e</em><em>d</em><em>/</em><em> </em><em>b</em><em>r</em><em>i</em><em>c</em><em>k</em><em> </em><em>r</em><em>e</em><em>d</em><em>.</em><em> </em><em>t</em><em>h</em><em>i</em><em>s</em><em> </em><em>r</em><em>e</em><em>a</em><em>c</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>i</em><em>s</em><em> </em><em>c</em><em>a</em><em>u</em><em>s</em><em>e</em><em>d</em><em> </em><em>b</em><em>y</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>r</em><em>e</em><em>d</em><em>u</em><em>c</em><em>i</em><em>n</em><em>g</em><em> </em><em>p</em><em>r</em><em>o</em><em>p</em><em>e</em><em>r</em><em>t</em><em>y</em><em> </em><em>o</em><em>f</em><em> </em><em>s</em><em>i</em><em>m</em><em>p</em><em>l</em><em>e</em><em> </em><em>c</em><em>a</em><em>r</em><em>b</em><em>o</em><em>h</em><em>y</em><em>d</em><em>r</em><em>a</em><em>t</em><em>e</em><em>s</em><em>.</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>c</em><em>o</em><em>p</em><em>p</em><em>e</em><em>r</em><em> </em><em>(</em><em>I</em><em>I</em><em>)</em><em> </em><em>i</em><em>o</em><em>n</em><em>s</em><em> </em><em>i</em><em>n</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>B</em><em>e</em><em>n</em><em>e</em><em>d</em><em>i</em><em>c</em><em>t</em><em>'</em><em>s</em><em> </em><em>s</em><em>o</em><em>l</em><em>u</em><em>t</em><em>i</em><em>o</em><em>n</em><em> </em><em>a</em><em>r</em><em>e</em><em> </em><em>r</em><em>e</em><em>d</em><em>u</em><em>c</em><em>e</em><em>d</em><em> </em><em>t</em><em>o</em><em> </em><em>C</em><em>o</em><em>p</em><em>p</em><em>e</em><em>r</em><em> </em><em>(</em><em>I</em><em>)</em><em> </em><em>i</em><em>o</em><em>n</em><em>s</em><em>,</em><em> </em><em>w</em><em>h</em><em>i</em><em>c</em><em>h</em><em> </em><em>c</em><em>a</em><em>u</em><em>s</em><em>e</em><em>s</em><em> </em><em>t</em><em>h</em><em>e</em><em> </em><em>c</em><em>o</em><em>l</em><em>o</em><em>r</em><em> </em><em>c</em><em>h</em><em>a</em><em>n</em><em>g</em><em>e</em><em>.</em>

8 0
3 years ago
Other questions:
  • What is the definition of ecology?
    7·2 answers
  • An animal that has body parts that extend outward from its center shows (1 point) radial symmetry. segmentation. several planes
    7·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • If Julie used a syringe on her gelding she is MOST likely
    7·2 answers
  • Do you think this dissolving process is the same for non-polar molecules as it is for the polar molecules?
    7·1 answer
  • Why is taxonomy important?
    12·1 answer
  • While looking at a cell under a microscope, a scientist is able to see a biological molecule. This molecule is a nuclei acid wit
    15·1 answer
  • Volcanoes occur only in oceanic crust? true or false
    11·1 answer
  • What does this sprout need to grow into a healthy plant?
    11·2 answers
  • What's The drug that takes days and weeks to recah equilibrium level
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!